ID: 951718565

View in Genome Browser
Species Human (GRCh38)
Location 3:25674292-25674314
Sequence GAGGCATCCCTGTACTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951718565_951718569 1 Left 951718565 3:25674292-25674314 CCCTGAGAGTACAGGGATGCCTC No data
Right 951718569 3:25674316-25674338 GTCTACAGCCACGGCTTGAGTGG No data
951718565_951718574 22 Left 951718565 3:25674292-25674314 CCCTGAGAGTACAGGGATGCCTC No data
Right 951718574 3:25674337-25674359 GGCTGCAGCTGTGCCTGGGAGGG 0: 37
1: 32
2: 87
3: 222
4: 738
951718565_951718573 21 Left 951718565 3:25674292-25674314 CCCTGAGAGTACAGGGATGCCTC No data
Right 951718573 3:25674336-25674358 TGGCTGCAGCTGTGCCTGGGAGG 0: 34
1: 21
2: 70
3: 163
4: 617
951718565_951718575 26 Left 951718565 3:25674292-25674314 CCCTGAGAGTACAGGGATGCCTC No data
Right 951718575 3:25674341-25674363 GCAGCTGTGCCTGGGAGGGCAGG 0: 19
1: 44
2: 100
3: 229
4: 837
951718565_951718572 18 Left 951718565 3:25674292-25674314 CCCTGAGAGTACAGGGATGCCTC No data
Right 951718572 3:25674333-25674355 GAGTGGCTGCAGCTGTGCCTGGG No data
951718565_951718567 -8 Left 951718565 3:25674292-25674314 CCCTGAGAGTACAGGGATGCCTC No data
Right 951718567 3:25674307-25674329 GATGCCTCAGTCTACAGCCACGG No data
951718565_951718571 17 Left 951718565 3:25674292-25674314 CCCTGAGAGTACAGGGATGCCTC No data
Right 951718571 3:25674332-25674354 TGAGTGGCTGCAGCTGTGCCTGG No data
951718565_951718576 27 Left 951718565 3:25674292-25674314 CCCTGAGAGTACAGGGATGCCTC No data
Right 951718576 3:25674342-25674364 CAGCTGTGCCTGGGAGGGCAGGG 0: 8
1: 30
2: 90
3: 503
4: 2433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951718565 Original CRISPR GAGGCATCCCTGTACTCTCA GGG (reversed) Intergenic
No off target data available for this crispr