ID: 951722373

View in Genome Browser
Species Human (GRCh38)
Location 3:25713786-25713808
Sequence CGGTAAGAATGGGAGGAAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951722368_951722373 -1 Left 951722368 3:25713764-25713786 CCACAGCTGCGATATTCAGTTTC No data
Right 951722373 3:25713786-25713808 CGGTAAGAATGGGAGGAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951722373 Original CRISPR CGGTAAGAATGGGAGGAAAT CGG Intergenic
No off target data available for this crispr