ID: 951723789

View in Genome Browser
Species Human (GRCh38)
Location 3:25732375-25732397
Sequence CCCCAAGTTCTCCAGGTTTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 224}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951723782_951723789 -2 Left 951723782 3:25732354-25732376 CCACTGACCCAGATATTCTTCCC 0: 1
1: 0
2: 0
3: 23
4: 280
Right 951723789 3:25732375-25732397 CCCCAAGTTCTCCAGGTTTAGGG 0: 1
1: 0
2: 0
3: 24
4: 224
951723778_951723789 26 Left 951723778 3:25732326-25732348 CCCATTTCACCTCGGGCTACTCT 0: 1
1: 0
2: 0
3: 6
4: 76
Right 951723789 3:25732375-25732397 CCCCAAGTTCTCCAGGTTTAGGG 0: 1
1: 0
2: 0
3: 24
4: 224
951723783_951723789 -9 Left 951723783 3:25732361-25732383 CCCAGATATTCTTCCCCCAAGTT 0: 1
1: 0
2: 0
3: 19
4: 237
Right 951723789 3:25732375-25732397 CCCCAAGTTCTCCAGGTTTAGGG 0: 1
1: 0
2: 0
3: 24
4: 224
951723780_951723789 17 Left 951723780 3:25732335-25732357 CCTCGGGCTACTCTCCAAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 951723789 3:25732375-25732397 CCCCAAGTTCTCCAGGTTTAGGG 0: 1
1: 0
2: 0
3: 24
4: 224
951723781_951723789 3 Left 951723781 3:25732349-25732371 CCAAGCCACTGACCCAGATATTC 0: 1
1: 1
2: 1
3: 14
4: 229
Right 951723789 3:25732375-25732397 CCCCAAGTTCTCCAGGTTTAGGG 0: 1
1: 0
2: 0
3: 24
4: 224
951723784_951723789 -10 Left 951723784 3:25732362-25732384 CCAGATATTCTTCCCCCAAGTTC 0: 1
1: 0
2: 2
3: 19
4: 192
Right 951723789 3:25732375-25732397 CCCCAAGTTCTCCAGGTTTAGGG 0: 1
1: 0
2: 0
3: 24
4: 224
951723779_951723789 25 Left 951723779 3:25732327-25732349 CCATTTCACCTCGGGCTACTCTC 0: 1
1: 0
2: 1
3: 1
4: 111
Right 951723789 3:25732375-25732397 CCCCAAGTTCTCCAGGTTTAGGG 0: 1
1: 0
2: 0
3: 24
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951723789 Original CRISPR CCCCAAGTTCTCCAGGTTTA GGG Exonic
900698981 1:4032270-4032292 CCCAGAGTCCTCCAGTTTTATGG - Intergenic
900814771 1:4835141-4835163 CTCCAAGTTCTTCAGTTTTGGGG - Intergenic
901121692 1:6899873-6899895 CACCAAGTTCACCAAGTTTATGG - Intronic
901176400 1:7302625-7302647 CCCCAACTCCTCCCAGTTTATGG - Intronic
901783683 1:11610671-11610693 CCCCAGGTTCTTCAGGGTTCCGG - Intergenic
902511500 1:16969326-16969348 CGCCAAGTACTCCAGGTCTCGGG + Exonic
904747840 1:32721827-32721849 CCCCAAGGTCACCCTGTTTAGGG + Intergenic
905206810 1:36347281-36347303 CCCCAAGTTCTCCATGTTGGAGG + Intronic
906194537 1:43921529-43921551 GCCCAAGATTTCCAGGTTTCAGG - Intronic
906945368 1:50290123-50290145 CCCCAAGATGTCCAGGTCTGAGG - Intergenic
909528230 1:76651519-76651541 CTCCAAGTTCTTCAGCTTTTGGG - Intergenic
909555186 1:76945720-76945742 CCTCCGGTTCTCCAGGCTTATGG + Intronic
910332003 1:86084328-86084350 CCCAAAGTTCTCCAGCTATCTGG - Intronic
912077073 1:105888436-105888458 CCCCAAGTTCTTCAGCTTTTGGG + Intergenic
916966036 1:169944384-169944406 TCCCAGTTTCTCCAGGTTTCTGG - Intronic
917015614 1:170528376-170528398 CCCCATGTTCTCCAGATGGAAGG + Intergenic
918173512 1:182021925-182021947 TCCCAAGATCTGCATGTTTAGGG + Intergenic
918828371 1:189356823-189356845 TACCAAGTGCTCCAGGTTTCAGG - Intergenic
921105470 1:211972787-211972809 CCACAAGTTCTTCAGGTGCAAGG + Intronic
921285715 1:213607517-213607539 CCCCATATTCTCCACCTTTAAGG - Intergenic
922371872 1:224919465-224919487 CCGCAAGTTATCCAGGTTCTTGG + Intronic
924527982 1:244868920-244868942 CCCCAACCTCCCCAGCTTTATGG - Intergenic
1065762891 10:28999518-28999540 CTCCAAGTTCTTCAGCTTTGGGG - Intergenic
1068090488 10:52427185-52427207 CTGCAAGTTCTTCAGTTTTAGGG + Intergenic
1068319980 10:55400140-55400162 CCCCAAGATGACCAGGTTTGGGG - Intronic
1069779267 10:70944592-70944614 CCCCAAGATATTCAGGGTTAGGG - Intergenic
1069817455 10:71207446-71207468 TCCTGAGTTCTCCATGTTTAAGG + Intergenic
1071251938 10:83827518-83827540 CTCCAAGTTCTTCAGCTTTTGGG + Intergenic
1071928184 10:90435614-90435636 CTCCAAGTTCTCCAGCCTTCTGG - Intergenic
1072564171 10:96603567-96603589 CTCCAAGTTCTCCAGTTTTGGGG + Intronic
1073429182 10:103475304-103475326 CCCCAACATCACCAGATTTAAGG + Intronic
1074034060 10:109720172-109720194 CTCCAAGTTCTTCAGCTTTTGGG + Intergenic
1074103512 10:110372488-110372510 CCCCTAGGTCTCCAGCTTGAAGG + Intergenic
1074420565 10:113305197-113305219 CCCCAAGTTCCCAAGGTGGATGG + Intergenic
1076719615 10:132387370-132387392 CCCCAAGTTCACCAGGAAGAGGG - Intergenic
1078506553 11:11953813-11953835 CCTAGAGTTCTCAAGGTTTAGGG + Intronic
1079902594 11:26205628-26205650 CCATAAGTTCCCCAGGTTTTCGG - Intergenic
1082727249 11:56751120-56751142 CCCCAATTTATCCATTTTTAAGG + Intergenic
1083594195 11:63911298-63911320 CCCCCATTTCTCCAAGTTTCTGG + Exonic
1084198516 11:67540408-67540430 CTGCAAGTTGTCCAGGTTCATGG - Intergenic
1093968048 12:25347700-25347722 CCCCAAGTTCCTCTGCTTTAGGG + Intergenic
1094027765 12:25976760-25976782 CTCCAAGTTGTCCAGGTTCTTGG - Intronic
1095795220 12:46211438-46211460 TACCAAGTTCTCCAGGGTTAGGG - Intronic
1097598943 12:61668516-61668538 CTCCAAGTTCTTCAGCTTTTCGG - Intergenic
1097628555 12:62031372-62031394 CTCCAAGTTCTTCAGTTTTTGGG + Intronic
1097695285 12:62769248-62769270 CCCCAAGTGGTGCAGGTTTGTGG - Intronic
1097920171 12:65063643-65063665 CACAAAGATCTCCAAGTTTAAGG + Intronic
1099059185 12:77884513-77884535 CTCCAGGTTCTCCAGCTTTTGGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099578374 12:84408025-84408047 CTCCAAGTTCTTCAAGTTTTGGG + Intergenic
1101551340 12:105765182-105765204 CCCCAAGTTCTCCAGCCTACTGG + Intergenic
1101713848 12:107293306-107293328 CTCCAAGTTCTTCAGCTTTTGGG + Intergenic
1101842996 12:108341358-108341380 CCCCAGGTTCTCCTGGTGAAAGG + Intergenic
1102283085 12:111633934-111633956 CCCCAAGCTCCCCAGGGTGAAGG + Intergenic
1103620522 12:122184537-122184559 CTCCAAGTTCGCCAAGTTTGAGG - Exonic
1104548096 12:129730835-129730857 CTCCAAGTTCTTCAGCTTTTGGG + Intronic
1106176915 13:27339637-27339659 CCCCAACTTCTCCAGGTCCTGGG + Intergenic
1106572599 13:30940737-30940759 CACCATGTTGTCCAGGCTTAAGG - Intronic
1106950877 13:34882177-34882199 CCCCAAATCTTACAGGTTTAAGG - Intergenic
1107666835 13:42699477-42699499 CTGCAAGTTCTCCAGTTTTGGGG - Intergenic
1107947764 13:45434999-45435021 CCCCAGGTGCTATAGGTTTATGG - Intergenic
1108467487 13:50731323-50731345 CTACAAGTTGTCCAGGTTTTTGG - Intronic
1109494171 13:63146752-63146774 CCGCAGCTTTTCCAGGTTTATGG + Intergenic
1111302771 13:86366675-86366697 CTCCAAGTTCTTCAGCTTTTGGG - Intergenic
1111540756 13:89664565-89664587 CCCCAATCTCTCCAGCTTTAGGG - Intergenic
1111614575 13:90646383-90646405 CTCCAAGTTCTTCAGTTTTGGGG - Intergenic
1112183463 13:97107108-97107130 CTCCAAGTTCTTCAGCTTTGGGG - Intergenic
1112414444 13:99192635-99192657 GCCCATGTTGTACAGGTTTATGG + Intergenic
1114191528 14:20442932-20442954 TCCCAAGTTCTCCAAGTTCCAGG + Intergenic
1116333764 14:43630526-43630548 CTCCAAGTTCTTCAGCTTTTAGG - Intergenic
1117219101 14:53583844-53583866 CCCCAATTTCTCCTCATTTAAGG - Intergenic
1118904326 14:70012555-70012577 CCCCAAATCCTCCAGGTCTCAGG - Intronic
1120654781 14:87176905-87176927 CTCCAAGTTCTTCAGCTTTTAGG + Intergenic
1121789427 14:96687806-96687828 CCCCTAGCTCTCCAGGTGTATGG - Intergenic
1123005936 14:105323859-105323881 CCCCAAGGCCTCCAGGGCTACGG - Intronic
1123133973 14:106010764-106010786 CCCAAATATCTCCTGGTTTAAGG + Intergenic
1128678210 15:69627372-69627394 CCCCAACCCCTCCAGGTTTTTGG + Intergenic
1129242070 15:74257725-74257747 CCCTGCCTTCTCCAGGTTTAGGG + Intronic
1133222448 16:4324530-4324552 GCCCAGGTTCTCCTGGTTCAGGG + Intronic
1134780259 16:16888947-16888969 TCCCAGGGTCTCCAGGTTTGAGG + Intergenic
1138129210 16:54465127-54465149 CCGCAAGTTGTCCAGGTTCTTGG + Intergenic
1140343833 16:74192779-74192801 ACCCAAGATCCCCAGGTTTCTGG - Intergenic
1141238829 16:82245623-82245645 CCCTTGGTTCTCCAGGATTATGG - Intergenic
1142038849 16:87879988-87880010 CCCCCAGTTACCCAGATTTAAGG + Intergenic
1142429009 16:90016435-90016457 CCCCAAGGTCTCCAGGGCCAGGG + Intronic
1144081279 17:11766557-11766579 CCTCATGTCCTCCAGGTTAAAGG + Intronic
1147001798 17:37368629-37368651 CCCCAATATTTCCAGGTTAATGG + Intronic
1150295334 17:64004402-64004424 GCCCAGGTTCTCCAGGGTCAGGG + Intronic
1150484240 17:65532935-65532957 TCCCAGGTTTCCCAGGTTTAGGG - Intronic
1155450500 18:25958364-25958386 CCGCAAGTTGTCCAGGTTCTTGG + Intergenic
1156178913 18:34580703-34580725 CACCAAGCTTTCCAGGTATATGG + Intronic
1156688224 18:39675508-39675530 TCCCAAGTTCTCCTTTTTTATGG - Intergenic
1159756874 18:72376619-72376641 CTCCAAGTTCTTCAGGTTTTGGG - Intergenic
1162472951 19:10883277-10883299 TCCCAAGTTGTCCAGGTGTGGGG + Intronic
1162688131 19:12405107-12405129 CTCCAAGTTCTTCAGTTTTGGGG + Intronic
1163839158 19:19595343-19595365 CCCCAAGTACTGCAGGCTGAGGG - Intronic
1165042137 19:33076162-33076184 CCTCAACTTCTCCAGGTTCAGGG - Intergenic
1166046260 19:40232829-40232851 CCCCACGTTCTGCAGCCTTAAGG - Exonic
1166673549 19:44725559-44725581 CCTCAGCTTCTCCAGCTTTAAGG + Intergenic
1168512638 19:56985498-56985520 CTCCAAGTTCACCAGGTTGTTGG + Intergenic
925106819 2:1298949-1298971 CTCCAAGTTCTTCAGTTTTGAGG + Intronic
926898865 2:17727394-17727416 CTCCAAGTTCTTCAAGTTTTGGG + Intronic
927028594 2:19096507-19096529 CTCCAAGTTCTTCAGCTTTTGGG + Intergenic
927104072 2:19809270-19809292 CCCCAAGTCCTCCAGCCTCAGGG + Intergenic
930105906 2:47639300-47639322 TCCCTAGTTCTCCAGCTTTGGGG - Intergenic
932569153 2:72928849-72928871 CCCCAAGTCTTCCAGGTCTGAGG - Intronic
933446236 2:82383293-82383315 CTCCAAGTTCTTCAGGTTTTGGG - Intergenic
935935489 2:108177902-108177924 CCCCAATTCCTCAAAGTTTAGGG + Intergenic
936411407 2:112261261-112261283 CCCCAACATTTCCAGGTTCAGGG - Intergenic
936486528 2:112930432-112930454 CTCCAAGTCCTGCAGGCTTAGGG - Intergenic
937223669 2:120356287-120356309 CCCCAAGTCCCCCAGGGTTCAGG - Intergenic
938997191 2:136692590-136692612 CTCCAAGTTCTTCAGCTTTGGGG - Intergenic
939341354 2:140899110-140899132 CATGAAGTTCTCCAGGTCTATGG + Intronic
939410347 2:141816453-141816475 CTCCAAGTTCTGCAGCTTTTGGG + Intronic
939756362 2:146117121-146117143 CTCCAAGTTCTTCAGCTTTTGGG - Intergenic
940109601 2:150136972-150136994 CCCCATGTTCTCTAGGCTTCGGG + Intergenic
940408357 2:153331526-153331548 CCCCAAGTTCTTCACTTTTGGGG - Intergenic
941540110 2:166771727-166771749 CCCCAACTACTCCAGGTGAATGG - Intergenic
942708867 2:178809270-178809292 CTCCAAGTTCTTCAGTTTTGGGG + Intronic
943150992 2:184113069-184113091 CTCCAAGTTCTTCAGTTTTGGGG - Intergenic
946026433 2:216674446-216674468 CCCCAAGTTCTATAGCTATAGGG + Exonic
947062031 2:226177847-226177869 AACCAAGTCCTTCAGGTTTAAGG + Intergenic
947505574 2:230705843-230705865 CCCTAAGTTCACCATGTTTTTGG + Intergenic
947529668 2:230900877-230900899 CCCCAACTCCTCCAGCTTTATGG + Intergenic
947921064 2:233874680-233874702 CTCCAAGTTCTTCAGCTTTGGGG + Intergenic
1170084159 20:12510496-12510518 CTCCAAGTTCTTCAGCTTTGGGG + Intergenic
1171046964 20:21817950-21817972 GTCCAAGTTCTCCAAGGTTAAGG + Intergenic
1174554479 20:51383947-51383969 CCCCAAGTTCTCCAGCCTCCAGG - Intergenic
1175930383 20:62491077-62491099 CTCCAAGTTCTTCAGCTTTGGGG + Intergenic
1176384864 21:6134244-6134266 CCCCAGTTTCTCCAGGTGTCAGG - Intergenic
1177160951 21:17547303-17547325 CCCCAACTTCTCAGGCTTTATGG + Intronic
1178424493 21:32468600-32468622 CTCCAAGTTCTTCAGTTTTGAGG - Intronic
1179416197 21:41200497-41200519 CCCCATGTTCTGCAGGTCTCAGG + Intronic
1179436366 21:41364750-41364772 CTCCAAGTTCTTCAGGTTTTGGG - Intronic
1179738608 21:43404008-43404030 CCCCAGTTTCTCCAGGTGTCAGG + Intergenic
1182360565 22:29744197-29744219 CACCATGTTCTCCAGGTATACGG + Intronic
1183259855 22:36787695-36787717 CCCCAGCTTCTCCAGGTCTTGGG - Intergenic
1185290976 22:50027565-50027587 CCCCAAGATCTGCAGATTCAAGG + Intronic
949360210 3:3223717-3223739 CCCCAAATTCTCTGGGTTTAAGG + Intergenic
950814243 3:15682020-15682042 CCCCTCATTCTCCAGGTATATGG + Intronic
951723789 3:25732375-25732397 CCCCAAGTTCTCCAGGTTTAGGG + Exonic
953319162 3:41956493-41956515 CCGCAAGTTGTCCAGGTTCTTGG - Intronic
954125431 3:48525313-48525335 GCCAAAGGTCTCCAGGTTGAAGG + Intronic
954608859 3:51933742-51933764 CCTCAAGTTCTCCAGCTCTGGGG - Exonic
955420725 3:58734524-58734546 CTCCAAGCTCTCCAGCTTTCTGG + Intronic
955443232 3:58979244-58979266 CCCCAAGTACTACAGGCTAATGG - Intronic
957277360 3:78108112-78108134 CTCCAAGTTCTTCAGTTTTGGGG - Intergenic
958036030 3:88171509-88171531 CTCCAAGTTCTCCAGCCTTTTGG + Intergenic
958778119 3:98509828-98509850 CTCCAAGTTCTCCAGCTATGGGG - Intronic
958829388 3:99068772-99068794 CTCCAAGTTCTTCAGCTTTTGGG + Intergenic
959633325 3:108533676-108533698 CCCCAATTCCTCCATGATTAAGG - Intergenic
960060966 3:113320699-113320721 CTCCAAGTTCTTCAGTTTTGGGG - Intronic
965600731 3:170452053-170452075 CACCCAGCTCTCCAGGTTCATGG - Intronic
967231616 3:187342590-187342612 CACCAACTTCTCCAGGTTCAGGG - Intergenic
968476843 4:814653-814675 CCCCTGGTTCTTCAGATTTAAGG - Intronic
970084644 4:12333097-12333119 CTCCAAGTTCTTCAGCTTTTGGG - Intergenic
971349836 4:25845901-25845923 CCACAGGTTCTCAAGTTTTAGGG + Intronic
975925288 4:79443923-79443945 CTCCAAGTTCTCCAGTTTTGGGG - Intergenic
975951997 4:79785194-79785216 TTCTAAGTTTTCCAGGTTTAGGG - Intergenic
976156554 4:82151240-82151262 CCCCAAGTGTTCTAGGTTCAAGG + Intergenic
977441886 4:97078015-97078037 CCCCAAGTTCTGTAAGTTTAGGG - Intergenic
977598951 4:98915208-98915230 CCCAAAGTGCTTCAGGTTTCAGG + Intronic
980318464 4:131237203-131237225 CCACAATTTGTCCAGGTTTTTGG - Intergenic
980750838 4:137085837-137085859 CTCCAAGTTCTTCAGTTTTGAGG - Intergenic
980868499 4:138582407-138582429 CTCCAAGTTCTTCAGTTTTGGGG + Intergenic
982640073 4:157947258-157947280 GCCCAAGTTCTACAGACTTAGGG + Intergenic
984122844 4:175767836-175767858 TCCCAAGGCCTCCAGGTTTCTGG + Intronic
986743282 5:10722373-10722395 CTCCAAGTTCTTCAGTTTTGAGG + Intronic
987158370 5:15114433-15114455 CTCCAAGTTCTTCAGCTTTGGGG - Intergenic
987668684 5:20980594-20980616 CTCCAAGTTCTTCAAGTTTTGGG - Intergenic
988226098 5:28412771-28412793 CTCCAAGTTCTTCAGTTTTAGGG + Intergenic
992945172 5:81802707-81802729 TCCCTAGATCTCCAGCTTTATGG - Intergenic
995247529 5:109951372-109951394 CCCCAAGTGTTCCAGGTCTTTGG - Intergenic
995286790 5:110398434-110398456 CCAAAAGTGCTCCAGGTTTGAGG + Intronic
997254494 5:132417959-132417981 GCTCCAGTTCTCCAGGGTTAAGG + Intronic
998778814 5:145633383-145633405 CCTCCAGTTCCCCAGGTCTAAGG + Intronic
999707915 5:154290964-154290986 TCCAAAGTCCTCCTGGTTTAGGG + Intronic
1000731774 5:164843602-164843624 ACCCAAGATCTCCAAGTTTTCGG - Intergenic
1002097031 5:176837486-176837508 ACCCAAGTTCTCCAGGGTGTGGG - Intronic
1003378553 6:5601956-5601978 CCACAAGTTCTCCACAGTTATGG - Intronic
1004211252 6:13647838-13647860 CTCCCAATTCTCCAGTTTTAAGG - Intronic
1006093346 6:31641146-31641168 CCCCAAGCAGTGCAGGTTTAGGG + Exonic
1006736836 6:36279617-36279639 CCCCAAGTTCTGTAGGTTCTTGG + Intronic
1011739941 6:90349549-90349571 CCAGAAGTTCTCAAGCTTTAGGG + Intergenic
1014433692 6:121398620-121398642 CCCCAAGTTCTTCAGCTTTGGGG - Intergenic
1014700955 6:124687021-124687043 CTCCAAGTTCTTCAGGTTTGAGG + Intronic
1015511620 6:134043413-134043435 CTCCAAATTCTACAGCTTTATGG - Intronic
1015949718 6:138539781-138539803 CCCCAAGTTCTCCTCGTTTTAGG + Intronic
1017584160 6:155901784-155901806 CACCAAGTACTTCAGCTTTAGGG + Intergenic
1018487004 6:164250709-164250731 CTCCAAGTTCTTCAGCTTTGGGG + Intergenic
1019029587 6:168998943-168998965 CTCCAAGTTCTTCAGCTTTGGGG - Intergenic
1019617436 7:1971825-1971847 CCACAAGCTCCCCAGGTTCAGGG + Intronic
1020802925 7:12754579-12754601 CACCAAGGCCTCCAGGTATATGG - Intergenic
1021865404 7:24951629-24951651 CCCCAAGTTCCCCAATTTAATGG + Intronic
1021904745 7:25322233-25322255 CCCCAACTCCCCCAGGTTCATGG - Intergenic
1026097888 7:67361204-67361226 CCTCAATTTCTCCAGGTGTGGGG + Intergenic
1026521477 7:71121841-71121863 CCTCAAGTTCCCCAGGCTCATGG - Intergenic
1028886287 7:95938057-95938079 CCCCAAGTTTTGCACGCTTAAGG - Intronic
1031176767 7:118362354-118362376 CTCCAAGTTCTTCAGCTTTGGGG + Intergenic
1031511286 7:122653322-122653344 CCCCACCTTCTCCATGTTTCAGG - Intronic
1031833347 7:126652673-126652695 CTCCAAGTTCTTCAGCTTTGGGG + Intronic
1036462887 8:8969755-8969777 CTGCAAGTTGTCCAGGTTAATGG + Intergenic
1036946014 8:13095583-13095605 ACCCCAATTCTCCAGGTTCAAGG - Intronic
1037563650 8:20097717-20097739 CTCCAAGTTCTTCAGTTTTGGGG - Intergenic
1039448688 8:37653366-37653388 CACCATGTTGTCCAGGTTTGTGG + Intergenic
1039983492 8:42428622-42428644 CTCCAGGTTCTCCAGGTCTCCGG - Intronic
1041015191 8:53586045-53586067 CCCCTAGTGCTGCAGGTTTGTGG - Intergenic
1045706351 8:104927336-104927358 TCCCAAGTTCCCCAGGTTTGAGG - Intronic
1047054055 8:121144838-121144860 CTCCAAGTTCTTCAGCTTTTGGG - Intergenic
1047744081 8:127830919-127830941 CTCCAAGTTCTTCAGTTTTGAGG + Intergenic
1048746465 8:137619777-137619799 CCCCTAGTTCTTCAGGTGGAAGG + Intergenic
1052227918 9:26110982-26111004 CTCCAAGTTCTTCAGCTTTGGGG + Intronic
1052391125 9:27879552-27879574 ACCCAGTTTCTCCAGGTTTTGGG - Intergenic
1053678899 9:40466272-40466294 CCCCAATTTCTTCTGGCTTATGG - Intergenic
1053928882 9:43094625-43094647 CCCCAATTTCTTCTGGCTTATGG - Intergenic
1054284824 9:63158671-63158693 CCCCAATTTCTTCTGGCTTATGG + Intergenic
1054291977 9:63301810-63301832 CCCCAATTTCTTCTGGCTTATGG - Intergenic
1054389997 9:64606352-64606374 CCCCAATTTCTTCTGGCTTATGG - Intergenic
1054505719 9:65910023-65910045 CCCCAATTTCTTCTGGCTTATGG + Intergenic
1054958534 9:70941334-70941356 CTCCAAGTTCTTCAGCTTTTGGG + Intronic
1058381318 9:104379940-104379962 CTCCAAGTTCTTCAGCTTTTGGG + Intergenic
1058648065 9:107149143-107149165 CCCCAAGATCACCAAGTTGATGG + Intergenic
1059335982 9:113568765-113568787 CTCCAGCTTCTCCAGGCTTAGGG - Intronic
1060540619 9:124427801-124427823 TCCCAGGTTCTCCAGGCTTTCGG + Intergenic
1062288862 9:135785735-135785757 CCCCACGTTCCCCAGGTTCGGGG + Intronic
1186019518 X:5238242-5238264 CCCCAAAGACACCAGGTTTATGG + Intergenic
1186757997 X:12693475-12693497 CCACAGGTTCTTCAGGGTTAAGG - Intronic
1190139723 X:47832233-47832255 CTCCAAGTTCTTCAGCTTTGGGG - Intergenic
1190604663 X:52128298-52128320 CCCCAAGCTCTCCTGGCTTGTGG - Intergenic
1190957687 X:55211453-55211475 CACCAAGTTGTCCAGGTTCTTGG - Intronic
1191872385 X:65759309-65759331 CCCCAAATTCTCCAGCTTGTTGG - Intergenic
1192158705 X:68766908-68766930 CCCCAAATTCTCCATCTTTCAGG + Intergenic
1192329314 X:70161866-70161888 GCCCAAGTTCTCCCAGTTTTGGG - Intronic
1192738223 X:73869253-73869275 CCCCGAGTTCTTCAGGTGAAAGG + Intergenic
1193250681 X:79288213-79288235 CCCCAAAATCTCCAGGTGAATGG + Intergenic
1193639581 X:83995480-83995502 CACCAAATTCTCCAGTTTTAGGG + Intergenic
1193792904 X:85838075-85838097 CTCCAAGTTCTTCAGCTTTTGGG - Intergenic
1194209877 X:91059118-91059140 CTCCAAGTTCTTCAGTTTTGGGG + Intergenic
1194474517 X:94342135-94342157 CTGCAAGTTCTCCAGGTTCTTGG - Intergenic
1194491549 X:94556053-94556075 CTCCAAGTTCTCCAGCTTTTGGG + Intergenic
1195883933 X:109620869-109620891 ACCCAAGTTCTCCTGATTTCTGG + Intergenic
1196759443 X:119188155-119188177 CTGCAAGTTGTCCAGGTTTTTGG - Intergenic
1197113712 X:122806361-122806383 CTCCAAGTTCTTCAGCTTTTAGG + Intergenic
1197554303 X:127935881-127935903 CTCCAAGTTCTTCAGCTTTGGGG - Intergenic
1197962499 X:132022630-132022652 CCACAAGTTCTGCACGTGTAAGG - Intergenic
1198385424 X:136124530-136124552 CCACAAGTTGTCCAGGTTCTTGG - Intergenic
1199388178 X:147247670-147247692 CCCTAAGTTCTCCAGAATTTAGG + Intergenic
1199989774 X:152980181-152980203 CCACAAGTTTTCCAGGTAGAGGG + Intergenic
1201264362 Y:12191788-12191810 CCTCCAGTTCTCCAGGTGGAAGG - Intergenic