ID: 951728381

View in Genome Browser
Species Human (GRCh38)
Location 3:25783761-25783783
Sequence CTGGTCGTACAGGTTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951728374_951728381 -9 Left 951728374 3:25783747-25783769 CCCAGAGTTGGGGCCTGGTCGTA 0: 1
1: 0
2: 2
3: 4
4: 66
Right 951728381 3:25783761-25783783 CTGGTCGTACAGGTTGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 88
951728369_951728381 14 Left 951728369 3:25783724-25783746 CCGGCAGGGGCGAGGTGCTTCGA 0: 1
1: 0
2: 0
3: 9
4: 74
Right 951728381 3:25783761-25783783 CTGGTCGTACAGGTTGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 88
951728375_951728381 -10 Left 951728375 3:25783748-25783770 CCAGAGTTGGGGCCTGGTCGTAC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 951728381 3:25783761-25783783 CTGGTCGTACAGGTTGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 88
951728368_951728381 20 Left 951728368 3:25783718-25783740 CCTCGGCCGGCAGGGGCGAGGTG 0: 1
1: 0
2: 6
3: 26
4: 231
Right 951728381 3:25783761-25783783 CTGGTCGTACAGGTTGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951728381 Original CRISPR CTGGTCGTACAGGTTGGGAA GGG Intronic
901095299 1:6674186-6674208 CTGGTTTTATAAGTTGGGAATGG + Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
908462481 1:64358799-64358821 TTGGACCTACAGGTTGGAAATGG + Intergenic
914845468 1:151281532-151281554 CGGGACCTAAAGGTTGGGAAGGG - Exonic
914858516 1:151369151-151369173 CTCGTCCTTCAGGTTGGGCATGG + Exonic
915068251 1:153244283-153244305 CTGGTAGTACATGTTGGTGAAGG + Intergenic
916192197 1:162190769-162190791 CGGGTCCTAGAGGCTGGGAAGGG - Intronic
1072225111 10:93361501-93361523 CTTGTCCTCCAGGTTGGGAATGG - Exonic
1072307562 10:94122024-94122046 CTGGTCTTATAGGTTGGCATTGG + Intronic
1073279701 10:102344353-102344375 CACGTTGTACAGGGTGGGAAGGG + Intronic
1080382386 11:31787181-31787203 CTGGTCCGGCAGGATGGGAACGG - Exonic
1082858198 11:57828330-57828352 CTGGTCGTAGAGGTCTGGAGTGG - Intergenic
1084549809 11:69834527-69834549 CTGGGCCTACAGGCTGGGATTGG + Intergenic
1084877084 11:72140976-72140998 CTCATCTTACAGGTGGGGAAAGG + Intergenic
1085692103 11:78672225-78672247 CTGGTCGTACAGAATCCGAAGGG + Exonic
1086224657 11:84493444-84493466 CTGGTTGGAGAGGATGGGAAGGG - Intronic
1086901005 11:92367303-92367325 CTGGTAGTAGAGGCTGGGCATGG + Intronic
1089296497 11:117472086-117472108 CTGGTACTTCAGGCTGGGAAGGG - Intronic
1093013116 12:14129253-14129275 CAGGATGTACAGGTTGGGAGAGG + Intergenic
1104750310 12:131234233-131234255 CAGGTGGTACAGATTGGGCATGG + Intergenic
1111024699 13:82504502-82504524 CTGGTCATACAGTTTGTTAAAGG + Intergenic
1111823617 13:93242994-93243016 CTGCTACTACAGGTTGGGACCGG + Intronic
1113454596 13:110439075-110439097 CTAGTCGTAAGGGTCGGGAAGGG + Intronic
1118456192 14:65947427-65947449 CTGGTAGACCTGGTTGGGAAAGG - Intergenic
1118492071 14:66270701-66270723 CTGGTGGGACACATTGGGAAAGG + Intergenic
1122121381 14:99555302-99555324 CTGGTAGGACAGGTGGGGACAGG - Intronic
1126790073 15:52212843-52212865 CTGGTCCTACAATTTGGAAAAGG + Intronic
1127754122 15:62074191-62074213 ATGGTGGTAAATGTTGGGAAAGG + Intergenic
1130963318 15:88679441-88679463 CTGGTCTTGCAGGTCGGGCATGG + Intergenic
1135164038 16:20123219-20123241 CTGGTACTACAGGCTGGGAGTGG - Intergenic
1136380468 16:29892215-29892237 CAGCTAGTGCAGGTTGGGAAGGG + Intronic
1138694990 16:58804735-58804757 CTGGTGGTAGAGGCTGGGCACGG - Intergenic
1145979282 17:29002323-29002345 ATGGTAGTACTGGTGGGGAATGG + Intronic
1153107721 18:1547234-1547256 CTGGGGAGACAGGTTGGGAAAGG - Intergenic
1163366923 19:16880677-16880699 CTGGACGGATAGGTTGGGCATGG - Intergenic
1165079055 19:33297486-33297508 CTGGTCTCACAGGAGGGGAAGGG - Intergenic
1168209000 19:54875274-54875296 TTTGTCGTAAAGGTTGGAAATGG + Intronic
926574975 2:14570196-14570218 CTGATCCTGCAGGTTTGGAAAGG - Intergenic
926676460 2:15626803-15626825 CTCCTCCTACAGATTGGGAAGGG + Intronic
927645486 2:24874464-24874486 CTGTGAGTGCAGGTTGGGAAGGG + Intronic
932302339 2:70676302-70676324 ATGCTCCTACAGGATGGGAAGGG - Intronic
941412778 2:165180512-165180534 ATGGTGGTAGTGGTTGGGAAAGG + Intronic
942182003 2:173388999-173389021 ATGGTTGTACAGTTTGTGAATGG - Intergenic
948852894 2:240717124-240717146 CTGGTGGAACAAGTTGGGAGAGG - Exonic
1170256248 20:14347503-14347525 CTGATTGTACAGGATGGTAAGGG + Intronic
1175830445 20:61962443-61962465 CTGGTCCTACAGCCTGTGAATGG - Intronic
1176237053 20:64058252-64058274 CTGGTCGGACAGGTGTGGATGGG - Intronic
1183466004 22:37980727-37980749 CTGGTCTCCCAGGTTTGGAATGG + Intronic
1183921772 22:41175562-41175584 CTTTTCCTACAGGTTTGGAAGGG - Intronic
1183933573 22:41249410-41249432 GGGGCCGTACAGGTTGGCAATGG + Exonic
1184039484 22:41934488-41934510 CTAGGCCTACAGGCTGGGAATGG - Intergenic
1184232180 22:43164117-43164139 CTGAGCGTACAGGTCGGGAGAGG - Intergenic
951728381 3:25783761-25783783 CTGGTCGTACAGGTTGGGAAGGG + Intronic
954118098 3:48478322-48478344 CTGGGCCTACAGGATGGGATGGG + Intronic
955077752 3:55629956-55629978 CTAGTCGTACTGGTGGGGAGGGG + Intronic
955600047 3:60635480-60635502 CAGGTAGTAGAGGTGGGGAAAGG - Intronic
957761632 3:84566369-84566391 CTCATAGTAGAGGTTGGGAAAGG - Intergenic
966750282 3:183315480-183315502 CTTGTCTTACAGGTTGGATAGGG + Intronic
971033893 4:22671603-22671625 TTGGTTGTACAGATTGAGAAGGG + Intergenic
973621892 4:52735169-52735191 CTGCTGGTAGAGGTTGGGCATGG - Intronic
974832567 4:67207483-67207505 CTGGACATACAGATTTGGAAGGG - Intergenic
983839641 4:172440671-172440693 CTGGTAGAACATGTTGGTAATGG + Intronic
991399052 5:66234742-66234764 CTGGGACTACAGGTTGAGAAAGG + Intergenic
991405126 5:66293944-66293966 CTGGGACTACAGGTTGAGAAAGG - Intergenic
991604650 5:68388602-68388624 CTGGGGGTGCAGGTTGGGAGAGG + Intergenic
992493818 5:77271865-77271887 CAGGTGGTACATGTTGGGGAGGG + Intronic
994016989 5:94978690-94978712 CTGGTAGTAGGGGTGGGGAATGG + Intronic
995311152 5:110713231-110713253 TTGTTAGTACAGGCTGGGAAAGG + Intronic
996283411 5:121759670-121759692 ATGTTTCTACAGGTTGGGAAGGG + Intergenic
1000452528 5:161407658-161407680 CTTTTAGTACAGGTTGGGAAAGG - Intronic
1002591404 5:180293261-180293283 GGGGTCGTACAGGATGGGAGAGG + Intergenic
1012442108 6:99270423-99270445 CTGGTGGCACAGCTTGGGAAGGG - Intergenic
1019823564 7:3264608-3264630 TTGGTGGAAAAGGTTGGGAATGG + Intergenic
1023153421 7:37223895-37223917 TTGGTGGTGCAGGGTGGGAATGG - Intronic
1024178978 7:46869877-46869899 CTGGGAGTCCAGGCTGGGAATGG - Intergenic
1027050523 7:75018724-75018746 CAGGTGGTGCCGGTTGGGAAGGG + Intronic
1030499893 7:110346968-110346990 CTGGTCGTACAGTGTGGGTAGGG + Intergenic
1031027458 7:116695907-116695929 CTGGGGGTACAGGTTATGAAGGG - Intronic
1040818102 8:51529938-51529960 TTGGTTGTACAGCTGGGGAAGGG - Intronic
1044490463 8:92808046-92808068 CTGACCGTACAGGCTGGAAAAGG - Intergenic
1048603072 8:135939806-135939828 CTTCTAGTTCAGGTTGGGAAGGG - Intergenic
1049251855 8:141593445-141593467 ATGGAGGTACAGGCTGGGAAGGG + Intergenic
1049719485 8:144109032-144109054 ATGGTGCTACAGGTGGGGAATGG - Exonic
1053298368 9:36931151-36931173 CTGGTCCTTCAGAATGGGAATGG - Intronic
1054721229 9:68606024-68606046 CTGGTGCTACAGGGTGGGGAGGG + Intergenic
1057046745 9:91892120-91892142 CTGGGCCTAGAGGTTGGGACAGG - Intronic
1060679017 9:125544825-125544847 ATGGTAGGACAGGCTGGGAAGGG + Intronic
1186439747 X:9575376-9575398 CTGGTTGCACCGGTTGGGACAGG - Intronic
1186524741 X:10238212-10238234 CTGGGGGTACAGCTGGGGAAAGG + Intergenic
1194514538 X:94835624-94835646 CTGGTGGTGGGGGTTGGGAATGG - Intergenic
1195553777 X:106198258-106198280 CAGGTGTTACAGGTGGGGAAGGG - Intronic
1199503649 X:148537293-148537315 ATTGTCGTAGAGGTGGGGAAAGG + Intronic
1202081567 Y:21089198-21089220 ATGTTCTTAGAGGTTGGGAAGGG + Intergenic