ID: 951729199

View in Genome Browser
Species Human (GRCh38)
Location 3:25791854-25791876
Sequence AGGTGCAGCTGTGCTGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 367}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951729192_951729199 15 Left 951729192 3:25791816-25791838 CCATTTCATCCAAAGAGAGATGG 0: 1
1: 0
2: 0
3: 17
4: 196
Right 951729199 3:25791854-25791876 AGGTGCAGCTGTGCTGGTGCTGG 0: 1
1: 0
2: 1
3: 37
4: 367
951729194_951729199 6 Left 951729194 3:25791825-25791847 CCAAAGAGAGATGGTTTTGTAAT 0: 1
1: 1
2: 5
3: 21
4: 266
Right 951729199 3:25791854-25791876 AGGTGCAGCTGTGCTGGTGCTGG 0: 1
1: 0
2: 1
3: 37
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951729199 Original CRISPR AGGTGCAGCTGTGCTGGTGC TGG Exonic
900153926 1:1196473-1196495 AGGTGTGGCTGTACAGGTGCGGG + Intronic
900284421 1:1892135-1892157 CCCTTCAGCTGTGCTGGTGCAGG - Intergenic
900389363 1:2427364-2427386 AGGGGCGGCTGAGCTGGGGCGGG - Intronic
900460397 1:2799935-2799957 GGGTGAGGCTGTGCTGGGGCTGG - Intronic
900530797 1:3152161-3152183 AGCTGCTGCTGTGATGGTGAAGG + Intronic
901166140 1:7222893-7222915 AGGTGCAGCTGTGAGGATCCGGG + Intronic
901187470 1:7384314-7384336 CGGGGCAGCTGGCCTGGTGCAGG + Intronic
901842592 1:11963541-11963563 AGGTGCAGCTGCGGTCCTGCCGG - Exonic
902602882 1:17551989-17552011 AGGAGGAGCTGGGCTGCTGCTGG + Intronic
902656303 1:17870789-17870811 AGGTTCAGCTATGTTGTTGCAGG + Intergenic
902684374 1:18066473-18066495 AGGGACAGCTGAGCTGGTCCAGG + Intergenic
902792822 1:18780724-18780746 AGAGGCAGCTGAGCTGGGGCTGG + Intergenic
902819987 1:18937905-18937927 AAGAGAGGCTGTGCTGGTGCCGG - Intronic
903341827 1:22659531-22659553 CGGTGCAGCTGAGCTGGGCCTGG - Exonic
904610548 1:31723869-31723891 GGCTGCAGCTGAGCTTGTGCGGG + Intergenic
905283092 1:36861522-36861544 AGCTGCGGCTGTGATGGGGCTGG - Intronic
905665414 1:39760629-39760651 AGGTGGAGCTGGGGTGGGGCTGG - Intronic
905670894 1:39789223-39789245 AGGAGCAGCTGAGCAGGTGCCGG - Intergenic
906460708 1:46033669-46033691 TGGTTCAGATGTGTTGGTGCAGG + Intronic
907300535 1:53483939-53483961 AGGTGCAGCAGAGCAGGGGCAGG + Intergenic
907513857 1:54980995-54981017 AGGTGAAGGTGTGGTGGTGGAGG - Exonic
908418230 1:63934024-63934046 AGCTGCTGCTTTGCAGGTGCAGG + Intronic
911072325 1:93842074-93842096 AGGTGCAGGTGTGGTGATACGGG - Intronic
915346802 1:155201621-155201643 AGGTGGAGCAGTGCTGGTCCTGG - Intronic
916673242 1:167044012-167044034 AGCTGCAGCTGTCTTGGAGCAGG - Intergenic
916895590 1:169158809-169158831 TGATGCAGCTGTTCTGGAGCAGG + Intronic
919478420 1:198056523-198056545 AGGGGCAGCAGTGCCTGTGCTGG + Intergenic
920365902 1:205448281-205448303 AGGTGCAGCTGCGCAGGAGAAGG + Intronic
920847462 1:209606147-209606169 GGGTGCAGGTGTGAGGGTGCAGG + Intronic
920868209 1:209770713-209770735 AGGTGGAGGTGTGCGTGTGCAGG + Intronic
920868212 1:209770733-209770755 AGGTGGAGGTGTGCGTGTGCAGG + Intronic
920868228 1:209770894-209770916 AGGTGAAGGTGTGCGTGTGCAGG + Intronic
920868230 1:209770914-209770936 AGGTGAAGGTGTGCGTGTGCAGG + Intronic
921051892 1:211516776-211516798 AGGAGTAGCTGTGAGGGTGCAGG + Intergenic
921785610 1:219225783-219225805 AGGTGAAGCTGTGATGAAGCTGG - Intergenic
921933574 1:220775546-220775568 AGGTGCAGGGGTACAGGTGCAGG + Intronic
922192438 1:223331444-223331466 AGGTTCAGCTGTGTTTTTGCTGG - Intronic
922592076 1:226784902-226784924 AGGTGAAGCTGTCTTGCTGCTGG + Intergenic
923085792 1:230702915-230702937 AGGTGCATTTGTGCCGCTGCAGG + Exonic
923274365 1:232383853-232383875 AGGTGCAGCAGATCTGGTGTCGG + Intergenic
924610395 1:245568632-245568654 AGGGCCAGCTGTGATGTTGCTGG - Intronic
1063421827 10:5918394-5918416 AGGTATAGATCTGCTGGTGCGGG - Exonic
1064133592 10:12731526-12731548 ATGTTCAGCTGCACTGGTGCAGG + Intronic
1064418932 10:15173520-15173542 AGGAGCTGCTGGGCTAGTGCTGG - Intergenic
1064559841 10:16585158-16585180 ACGTGGAGCTTTGCTGTTGCCGG - Intergenic
1066446481 10:35488482-35488504 GTGTGCAGGTGTGCAGGTGCTGG + Intronic
1067330083 10:45307143-45307165 AGCTGCAGCTGTGCTGACTCTGG - Intronic
1068072301 10:52210346-52210368 GGGTGCAGCTGTGACGGTCCTGG - Intronic
1070060711 10:72980790-72980812 GGGTGCAGGTCTGCTGGTGGTGG + Intergenic
1070644317 10:78190958-78190980 AGGTGGAACTTCGCTGGTGCTGG - Intergenic
1070852978 10:79582907-79582929 ATGTGTACCTGTGCTGGGGCAGG - Intergenic
1070924151 10:80207214-80207236 CTGGGCAGGTGTGCTGGTGCCGG + Intergenic
1071341562 10:84653560-84653582 AGGGGCAGCAGTGATGGTGCTGG + Intergenic
1071428398 10:85582627-85582649 CAGTGCAGCTGAGCTTGTGCAGG + Intergenic
1071488011 10:86115740-86115762 AGGAGCAGCTGGGATGGGGCTGG - Intronic
1073467942 10:103705086-103705108 AGTTGCAGCTGAGCTGGCCCAGG - Intronic
1073700917 10:105925691-105925713 AGCAGCACCTGTGCTGGTGGAGG - Intergenic
1074717732 10:116235439-116235461 AGGGGCAGCAGTTTTGGTGCAGG - Intronic
1075556507 10:123436255-123436277 GGGTGACCCTGTGCTGGTGCAGG + Intergenic
1076379235 10:130013995-130014017 TGGGGCAGCTGTGCTGGGGAGGG - Intergenic
1076764225 10:132624411-132624433 AGGTGCAGGTGTGCTGGTGAGGG - Intronic
1076882723 10:133247485-133247507 AGGTGCAGGTGCACTGGTGCAGG + Intergenic
1077164653 11:1129602-1129624 TGGTGCAGCTGTCCTGCAGCTGG + Intergenic
1078086234 11:8234437-8234459 AGGGGCAGCTGGGCTGGGACAGG - Intronic
1081867582 11:46367922-46367944 AAGGGCAGCTGTGCTGGGGCAGG + Intronic
1083452040 11:62752755-62752777 AGCTGAAGCTGAGCTGGTCCAGG - Exonic
1083656525 11:64232415-64232437 GGGTGCAGCTGGGGTGGGGCAGG - Exonic
1085142628 11:74161536-74161558 AGATATGGCTGTGCTGGTGCTGG - Exonic
1090255545 11:125281188-125281210 AGGTGGCTCTGAGCTGGTGCTGG - Intronic
1091222288 11:133936598-133936620 AAGTCCAGCAGTCCTGGTGCTGG + Intronic
1091226051 11:133956941-133956963 AGGTGCCGCTGCGCCGGGGCCGG - Exonic
1092105925 12:5921767-5921789 TGGTGCAGGAGTGCTGGTGCAGG - Intronic
1092180188 12:6441561-6441583 GGGGGCAGCAGTGCTGGTGGTGG + Intergenic
1092228928 12:6766374-6766396 GGCGGCAGCTCTGCTGGTGCGGG + Exonic
1093151263 12:15624671-15624693 ATATTCAGCTGTGCAGGTGCAGG - Intronic
1093300675 12:17450663-17450685 AGGTTCAGCGGTTCTGTTGCTGG + Intergenic
1093616911 12:21236468-21236490 TGGTGCAGCTGTACCTGTGCAGG + Intronic
1094040986 12:26122155-26122177 GGGTGCGGCCGTGCGGGTGCTGG + Exonic
1094437722 12:30439922-30439944 ATATGCAGCTGTGCTGATGGCGG + Intergenic
1096180958 12:49550059-49550081 AGCTGCAGGTGAGCAGGTGCGGG - Exonic
1097140618 12:56899971-56899993 AGGAGCAGCAGTGGTGGTGGGGG + Intergenic
1098067722 12:66637021-66637043 CAGTGCAGCTGTGCTGGACCAGG - Intronic
1098658703 12:73067176-73067198 AGGTGCAGGCTTGCTGATGCAGG + Intergenic
1099608564 12:84836165-84836187 AGATGCTGCTTGGCTGGTGCTGG + Intergenic
1100189614 12:92176767-92176789 AGGAGCAGATGAGATGGTGCTGG + Intergenic
1102943727 12:116966608-116966630 ATGTGCAGGGGTGCTGCTGCTGG + Intronic
1103100243 12:118168177-118168199 AGGTGAAGATGGGCTGATGCTGG + Intronic
1103145780 12:118594829-118594851 AGGTGGGGCTGTGGAGGTGCTGG + Intergenic
1103721081 12:122975878-122975900 AGGAGGAGCTGTGCAGGGGCAGG - Intronic
1103763397 12:123266555-123266577 GGGTGCAGCTGAGATGGTGGCGG + Intronic
1103775639 12:123364715-123364737 GGGAGGAGCTGTGCTGGCGCCGG - Intronic
1104036248 12:125098961-125098983 AGGTGCAGGTGGGCTGGGGGTGG + Intronic
1104892881 12:132148769-132148791 AGGGGCAGCTGGGCGGGGGCCGG - Exonic
1105202407 13:18191515-18191537 AGGTGCAGATGAGTTGATGCGGG + Intergenic
1105278078 13:18947792-18947814 AGGTGCAGCTGTGCCTGTTCAGG - Intergenic
1105851583 13:24340406-24340428 AGGTGCGGCGGTGCAGGAGCAGG + Intergenic
1105950893 13:25228744-25228766 AGGGGCAGGTGTGCAGGTGAGGG - Intergenic
1107958955 13:45542500-45542522 AGGGGCAGCTGTGCCTGTGCAGG - Intronic
1108492836 13:50998763-50998785 GGGTGAAGCCGTGGTGGTGCAGG - Intergenic
1110783005 13:79489027-79489049 AGGCCCAGCTGTGATGGAGCTGG + Intronic
1111119142 13:83823567-83823589 AGCTGCAGCTGTGCTGGGAAAGG - Intergenic
1112287800 13:98119297-98119319 AGGAGCAGCACAGCTGGTGCAGG + Intergenic
1113890458 13:113732623-113732645 GGGTGCGGCTGTGCTGGGGGTGG + Intronic
1113891475 13:113737830-113737852 AGGTGCACCTGAGCAGGCGCAGG + Intergenic
1116118247 14:40685397-40685419 AATTGCAGCTGAGCTGGTTCAGG - Intergenic
1118885023 14:69859262-69859284 AGGTGCAGATGTGATGCTGCTGG + Intronic
1119257286 14:73209161-73209183 AGCTGCAGCTGTGGGAGTGCGGG + Intronic
1120186170 14:81395916-81395938 AGGTGGAGATGTGCTGGCCCAGG + Exonic
1120607523 14:86597538-86597560 AGCTGGGGCTGTGATGGTGCTGG + Intergenic
1121062805 14:90932042-90932064 ATGTGTAGCTGCACTGGTGCAGG - Intronic
1121192700 14:92044157-92044179 GGGGGCAGCTGTGTAGGTGCAGG + Exonic
1121272063 14:92644366-92644388 AGGAGAAGCTGTGCTCTTGCAGG - Intronic
1121928365 14:97949267-97949289 AGGTCCTGCTGTGCTGGGGGAGG + Intronic
1122449455 14:101793510-101793532 AAGTGCAGGTGAGCTGGTGCAGG + Intronic
1122717466 14:103704141-103704163 AGGTTCATCCGTGCTGGAGCAGG - Intronic
1122856289 14:104561778-104561800 AGCTGGAGCTGAGCTGGAGCTGG - Intronic
1123004915 14:105316497-105316519 ATGTGCTGCAGTGCTGGAGCAGG - Intronic
1123098946 14:105782764-105782786 ACGTGCAGCTGCAATGGTGCTGG + Intergenic
1123700407 15:22910505-22910527 ATGTGCAGGTGAGCTGGGGCCGG - Exonic
1124257215 15:28153953-28153975 AGGGGCAGCTGTGTTGGGGTCGG - Intronic
1124567117 15:30826544-30826566 AGGGGCAGCTGTGTTGGGGTTGG + Intergenic
1124817706 15:33012799-33012821 AGTGGCAGCTGTGGTGGTGGAGG + Intronic
1124818702 15:33021214-33021236 AGGTTCAGCTGAGCTGGTTTGGG - Intronic
1127530500 15:59839016-59839038 AGGAGCAGCTTTCCAGGTGCTGG + Intergenic
1128233605 15:66052229-66052251 AGGTGGGGCTGTGCTGGGGGTGG + Intronic
1128419058 15:67474254-67474276 AGGTGCTGCTGGTCTGGAGCTGG - Intronic
1128463393 15:67888495-67888517 ACGTGCAGCTGTGATGGACCAGG + Intergenic
1128514255 15:68332317-68332339 AGGTACAGCTGGGCAGGGGCTGG - Exonic
1130144276 15:81261486-81261508 TGGTGCTGCAGTGCTGGTGGTGG + Intronic
1131881597 15:96868090-96868112 ACGTGCAGGTGAGCAGGTGCAGG - Intergenic
1131971072 15:97893530-97893552 AGGTGCAATTGTTCTGGTGGTGG + Intergenic
1132644139 16:990992-991014 CGGAGCAGCCGGGCTGGTGCTGG + Intergenic
1132656737 16:1044611-1044633 AGGTGGCCCTGAGCTGGTGCTGG + Intergenic
1132703308 16:1231058-1231080 ATGGGCAGCTGGGCTGGGGCTGG - Intergenic
1132758968 16:1499814-1499836 AGCTGCTGCCGTGCTGGGGCAGG - Intronic
1133102336 16:3486972-3486994 AGGTGCAGCCAGGCGGGTGCGGG - Intergenic
1133103117 16:3491131-3491153 AAGAGCAGCTGTGATGGGGCAGG - Intergenic
1134402189 16:13920371-13920393 AGGTGCGGCCGCGCTGGCGCGGG + Exonic
1135078969 16:19417751-19417773 AGGTGCAGCTGTGATGGTAGAGG + Intronic
1135197239 16:20404536-20404558 AGGTGGGGCTGTGCTGGGGGTGG + Exonic
1135587172 16:23679894-23679916 AGATGCCGCTGTGCTGGAGAAGG + Intronic
1135733919 16:24915896-24915918 AGGAGGAGATGTGCTGGTGCGGG - Intergenic
1136111761 16:28067836-28067858 TGGTGCAGCTGTGGCAGTGCAGG - Intergenic
1136345675 16:29674222-29674244 TGGTTCAGCTGGGCTGGTGATGG - Intronic
1136402890 16:30028180-30028202 TGGGACAGCTGGGCTGGTGCAGG + Intronic
1136549916 16:30977521-30977543 TGCAGCAGCTGTGCTGGTGGAGG + Intronic
1137588520 16:49679345-49679367 GGCTGCAGCTGTGCTGGGGAGGG - Intronic
1139974820 16:70801070-70801092 AGGGTCAGGTGTGCTGGAGCGGG - Exonic
1141954438 16:87360983-87361005 AAGTGCAGCTGTGGTGGGGTGGG - Intronic
1142024622 16:87805881-87805903 AGGTGCAGCTCACCTGGTTCTGG + Intergenic
1142232088 16:88904733-88904755 GGGGGCAGCTGTGCAGGTGATGG + Intronic
1142414142 16:89932286-89932308 AGGCCCAGCTGTGCAGCTGCTGG - Intronic
1143114649 17:4575771-4575793 AGGTGGGGCTGGGCTGGGGCTGG + Intergenic
1143380894 17:6495777-6495799 CCTTGCAGCTGTGCTGGTGAAGG - Intronic
1143762694 17:9116448-9116470 AGGGGCAGCTGCGATGGTGGAGG + Intronic
1144502873 17:15804854-15804876 AGGTGCTGAAGAGCTGGTGCAGG - Intergenic
1144737597 17:17563817-17563839 GGGTGGGGCTGTGCTGGAGCTGG - Intronic
1145165054 17:20607519-20607541 AGGTGCTGAAGAGCTGGTGCAGG - Intergenic
1146056337 17:29583161-29583183 AGATGGAGGTGTGGTGGTGCGGG - Intronic
1146980899 17:37160595-37160617 AAGTTCAGCTGGGCAGGTGCAGG + Intronic
1148050864 17:44769415-44769437 AGGTGCAGCTGGGATGGAGAGGG - Intronic
1148107508 17:45127268-45127290 AGGTGCCGCTGTCCTGGTCTGGG - Intronic
1148456532 17:47814326-47814348 AGGAGCAGCTCTGCTGGGGTGGG - Intronic
1150104052 17:62448716-62448738 AGGTGCCTCTCAGCTGGTGCTGG - Exonic
1150137294 17:62703045-62703067 GGAAGCAGCTGTCCTGGTGCTGG + Intronic
1151661661 17:75522193-75522215 AGGTGCAGCGGTGCTCCAGCTGG + Exonic
1151680858 17:75621952-75621974 AGCTGGGGCTGTGCTGGGGCTGG - Intergenic
1152116344 17:78389962-78389984 AGGTGCCGCTGTACTGCTCCAGG - Intronic
1152531281 17:80920676-80920698 AGGCGCTGCTGGGCTGGGGCCGG - Intronic
1152594068 17:81229657-81229679 AGCAGCTGCTGGGCTGGTGCTGG + Intronic
1153615744 18:6931331-6931353 AGGTGAAGTTGTGGCGGTGCGGG - Intergenic
1156394573 18:36687449-36687471 AGGCTCAGCAGTGGTGGTGCAGG - Intronic
1156503391 18:37574208-37574230 ATGTGCAGGTGTGTGGGTGCAGG - Intergenic
1158156628 18:54432980-54433002 AGGAGCAGCAGTGCTGGTACTGG - Intergenic
1158408748 18:57186205-57186227 TGGTGCAGCTTTGCTGGGGCTGG + Intergenic
1159505429 18:69329187-69329209 AGGTTCAGGGGTGCTTGTGCAGG - Intergenic
1160236502 18:77090024-77090046 ACCTGCAGCTTTGCAGGTGCAGG + Intronic
1161054216 19:2181788-2181810 TGCTGCAGCTGGGCTGGGGCTGG - Intronic
1161972508 19:7590547-7590569 AGGTCCAGAGGTGTTGGTGCAGG - Intergenic
1163533520 19:17864099-17864121 AAGTGACGCTGTGCAGGTGCTGG + Intronic
1163815740 19:19463490-19463512 AGGGGCAGCTGAGCAGGAGCGGG + Intronic
1164618891 19:29682171-29682193 GGGCGTAGCTGTGCTGCTGCGGG - Intergenic
1165370486 19:35402578-35402600 AGGTACAGCTGGGCTGCAGCAGG + Intergenic
1166155471 19:40908450-40908472 AGGGAGGGCTGTGCTGGTGCCGG - Intergenic
1166359320 19:42246231-42246253 AGTTGCAGCTGAGTTGGTGGTGG - Intronic
1166768378 19:45265764-45265786 AGATGCAGGTGTGAGGGTGCCGG + Intronic
1166768388 19:45265805-45265827 ATGTGCAGGTGTGAGGGTGCCGG + Intronic
1167497635 19:49828884-49828906 ATGTGCATCTCCGCTGGTGCTGG + Intronic
1167611250 19:50508626-50508648 AGGTGCAGCTGTTCAGAGGCAGG - Intronic
1168181734 19:54666455-54666477 AGGTGCACCTGGGGTGGAGCTGG + Intronic
1168591044 19:57634315-57634337 AGGTGAGGCTGAGCTGGTTCAGG + Intronic
1168630359 19:57951071-57951093 AGGGGCCGCTGTGATGATGCCGG - Intergenic
1168648968 19:58080683-58080705 AGGGGCAGCTGGGCTGGTTCAGG - Intronic
925142823 2:1561670-1561692 AGAGGCAGCAGTGCTGGAGCTGG + Intergenic
925891770 2:8440152-8440174 GGGAGCAGCTTTCCTGGTGCAGG + Intergenic
927392554 2:22611584-22611606 AGTTGCACCTGTGCTTGTGGTGG + Intergenic
928071270 2:28219874-28219896 AAATGAAGCTGTGCTGCTGCTGG + Intronic
929600170 2:43199759-43199781 GGATGTAGCTGTGCTGGGGCTGG + Intergenic
931463480 2:62467699-62467721 AGGTGGAGCTGTGATGATTCAGG + Intergenic
932501710 2:72188037-72188059 GGCTGCAGCTGTGCTGGGGGTGG + Intronic
933377269 2:81495895-81495917 TGCTGCAGCTGTGATGGAGCTGG - Intergenic
934055843 2:88250892-88250914 AGGAGCAACTGTGCATGTGCAGG + Intergenic
935088414 2:99870500-99870522 AGATCCAGCAGGGCTGGTGCAGG - Intronic
936146951 2:109986656-109986678 AGGTGGTGCTGGGCTGGGGCTGG - Intergenic
936197741 2:110384827-110384849 AGGTGGTGCTGGGCTGGGGCTGG + Intergenic
937370969 2:121296829-121296851 AGCTGCAGCAGGGGTGGTGCAGG - Intergenic
938730053 2:134140330-134140352 TGGAGCAGCTGTGCTGCTGTGGG + Intronic
940855014 2:158723067-158723089 GGGAGGAGCTGTGCTGGGGCAGG - Intergenic
942311499 2:174661133-174661155 TGTTGCAGCTGTCCTAGTGCAGG - Intronic
944621405 2:201519187-201519209 TGGTGCGGCTTTGCTGGTGGTGG - Intronic
945714476 2:213340704-213340726 AAGTGCAGCTGTGGTATTGCAGG + Intronic
947363427 2:229369556-229369578 AGGACCAGCTGTGGTGGTGGAGG + Intronic
947534911 2:230934359-230934381 AAGAGCAGCTGTGCTGGGGTCGG - Intronic
948077818 2:235180050-235180072 AGGTTCAGGTGTACTCGTGCAGG + Intergenic
948987607 2:241534815-241534837 AGACGCAGGTGAGCTGGTGCGGG + Intergenic
1169321196 20:4634596-4634618 AGGTGCAGCTCTGCTGGGTGAGG - Intergenic
1169351582 20:4872461-4872483 AGAGGCAGCTGTACAGGTGCTGG - Intronic
1170434622 20:16313547-16313569 AAGTGCAGCTCTGGGGGTGCTGG - Intronic
1170454172 20:16517080-16517102 AGGTGCAGCTGAGATGGAGATGG - Intronic
1172006983 20:31824424-31824446 AGGTTCAGCAGCGCTGGTGGAGG - Intronic
1172626403 20:36349984-36350006 AGGCACAGCTGTGCTGATGCCGG + Intronic
1172906533 20:38374198-38374220 AGTGGCACCTCTGCTGGTGCAGG + Intronic
1173166297 20:40689225-40689247 CGGTGCAGCTGTGCTGGATCCGG + Exonic
1175222540 20:57425674-57425696 AAGTGCAGCTGTGCTGGGGGAGG - Intergenic
1175445687 20:59018048-59018070 AGGTGCAGGTGGGCAGGTACAGG - Intergenic
1175826602 20:61939552-61939574 AGGTGGAGCTGGGAAGGTGCAGG - Exonic
1175913529 20:62415529-62415551 ATGTGCAGCTGGGCCGGCGCAGG - Intronic
1176039572 20:63058087-63058109 AGGGGCTGCTGAGCTGCTGCAGG - Intergenic
1176088139 20:63307306-63307328 ATGTGCAGCCGTGCCGGTGTGGG + Intronic
1176233724 20:64044690-64044712 ATGTGTGTCTGTGCTGGTGCTGG + Intronic
1176715546 21:10346493-10346515 AGGTGCAGATGAGTTGATGCAGG - Intergenic
1177768006 21:25480557-25480579 TGGTGCAGCTTTGCTGGGGGTGG - Intergenic
1177894538 21:26844401-26844423 AGGTGGAACTGTAGTGGTGCCGG + Exonic
1178635558 21:34299188-34299210 TGGCTCAGGTGTGCTGGTGCAGG + Intergenic
1179568689 21:42265113-42265135 AGCTGCAGCTGTGCTCGGGCAGG + Intronic
1179912771 21:44459203-44459225 GGGTGCACCCGTGCTGGTGTGGG + Exonic
1180602803 22:17033460-17033482 AGGTGCAGATGAGTTGATGCGGG + Intergenic
1181119273 22:20654744-20654766 TAGTGCAGCTGTGCTGGAGCGGG - Intergenic
1181568029 22:23751422-23751444 CGGGGCATCTGCGCTGGTGCTGG + Intergenic
1181902007 22:26163931-26163953 GTGTGCTGCTGTGCTGATGCAGG + Intergenic
1182583219 22:31327729-31327751 GGGTGCAGCTAGTCTGGTGCAGG - Intronic
1182592880 22:31395917-31395939 AGCTGCACATCTGCTGGTGCTGG + Intergenic
1183335606 22:37244245-37244267 AGGAGCAGCGGTGGTGGGGCAGG + Exonic
1183529803 22:38347253-38347275 AGGTTCAGCTGAGCTGGGGTCGG + Intronic
1184245536 22:43234096-43234118 AAGCCCAGCTGTGCTGGTCCAGG + Intronic
1184788226 22:46682179-46682201 AGGGGCAGCTGGGGTGGGGCTGG + Intergenic
1184821874 22:46915542-46915564 AGCTGCAGCTGGCCTGGTTCTGG + Intronic
1185003911 22:48263979-48264001 ATGTCCTGCTGTTCTGGTGCAGG - Intergenic
949217119 3:1583449-1583471 GGGTTCATGTGTGCTGGTGCAGG + Intergenic
950833053 3:15894014-15894036 GGGAGCAGCTGTGCTGGAACTGG + Intergenic
951729199 3:25791854-25791876 AGGTGCAGCTGTGCTGGTGCTGG + Exonic
952968664 3:38637039-38637061 TGGAGCAGCTGTCCTGGTGGGGG - Intronic
953203398 3:40798312-40798334 AGAGGCAGCTGTGTTGGTCCTGG + Intergenic
953561343 3:43995721-43995743 ATGTGCAGGTGTCCTTGTGCGGG - Intergenic
954616563 3:51971674-51971696 TGCTGCTGCTGTGCTGGTGAAGG + Exonic
956517690 3:70067707-70067729 AGCTGCAGCTGTGCCTGTACTGG + Intergenic
957878846 3:86183986-86184008 AGGAGCATGTGTGCTGGTGGAGG - Intergenic
959150394 3:102600497-102600519 AGATGCTGCTGTGGTGGTGCAGG + Intergenic
959513656 3:107241450-107241472 AGGAGCAGAGGTGCAGGTGCAGG - Intergenic
960777465 3:121274531-121274553 ACATGCAGCTGTGGTGGTGTTGG + Intronic
960958776 3:123054392-123054414 ATTTGCAGGTGTGCTGGTGCAGG - Intergenic
960967790 3:123116966-123116988 AGGAGCAGCTGGGATGGGGCGGG + Intronic
961021979 3:123515519-123515541 AGGGGCTGCAGTGCTGGTGCTGG + Intronic
961117032 3:124339232-124339254 GGGTGCAGGTGGGCTGGGGCTGG + Intronic
961695522 3:128701485-128701507 AAGAGCAGCAGTGATGGTGCAGG - Intergenic
961745383 3:129061027-129061049 AGGGGGAGCTCTGCTGGTGGAGG + Intronic
962352150 3:134663998-134664020 AGCTGCTGCTGGGCTGCTGCAGG + Intronic
962446522 3:135470892-135470914 AGATGATGCTGTGCTGCTGCTGG + Intergenic
963586460 3:147196167-147196189 TGGTGCTACTGTGCTGATGCTGG + Intergenic
963706785 3:148698073-148698095 AGGGCCGGCTGCGCTGGTGCGGG - Exonic
963830272 3:150000253-150000275 AGAGGCAGCTGTGGTGGTGGTGG + Intronic
965813676 3:172615434-172615456 AGGAGCAGCAGTGGTGGTGGTGG - Intergenic
965841562 3:172911327-172911349 AGGTGCTGCTCAGCTGGTACTGG - Intronic
967197386 3:187040293-187040315 AGGTGCAGCACTGATGGTGAAGG + Intronic
968123243 3:196141021-196141043 AGGTGCAGTGGTGCTTGTGGTGG + Intergenic
968233189 3:197016141-197016163 AGGTTGAGCTGGGCTGGAGCTGG + Intronic
968526599 4:1061239-1061261 TGGTGCAGCTGTGCTCTTGCTGG - Intronic
968649862 4:1756253-1756275 GGGTGCAGCTTTGCTGGGGAAGG - Intergenic
968984881 4:3869727-3869749 GGCTTCAGCTGTGCAGGTGCCGG - Intergenic
969050953 4:4372640-4372662 TGGTGAAGATGTGTTGGTGCTGG - Intronic
969459689 4:7322375-7322397 AAGTGCAGCTGGGCTGGGCCAGG - Intronic
969464655 4:7349186-7349208 AGGGGCAGCATGGCTGGTGCTGG + Intronic
969567508 4:7987469-7987491 AGGTGCACCTGTTCTGGTCAGGG + Intronic
970007698 4:11427325-11427347 AGGCGCAGCCGAGCTGGTGGTGG + Intronic
975156813 4:71081437-71081459 CACTGCAGCTGTGCTGGTGCTGG + Intergenic
977471778 4:97452134-97452156 AGCTGCAGCTGTGCTGGGGGCGG - Intronic
979404600 4:120294094-120294116 AGGTGAAGTTCTCCTGGTGCAGG + Intergenic
983542955 4:168931754-168931776 TGGTGCAGCTTTGCTGGGGTGGG - Intronic
984102343 4:175500210-175500232 AGGTACAGCAGTGGTGGTGGTGG - Intergenic
984574499 4:181431944-181431966 TTGTGAAGCTGTGCTGGTGATGG + Intergenic
984698150 4:182799666-182799688 AGGTGCAGGTGAGCCGGCGCCGG + Exonic
984765094 4:183394259-183394281 AGGGGCAGCTGTGCTGGGACTGG + Intergenic
985381179 4:189396579-189396601 ACGTGCTGCTGCGCTGGTGCAGG + Intergenic
985493385 5:191894-191916 AGGTGCAGCGGTGCCCGTGCGGG + Exonic
985606342 5:860132-860154 AGGAACAGCTGGGCTGGGGCGGG + Intronic
985965159 5:3333890-3333912 AGGTGCAGGGGCGCTGGTGGGGG + Intergenic
986074359 5:4319402-4319424 GGGGGAAGCTGTGCTTGTGCTGG - Intergenic
987110130 5:14678208-14678230 GGGAGCAGCTCTGCAGGTGCGGG + Intronic
988938784 5:36119571-36119593 ATGTGCAGCTGTGTGGATGCAGG - Intronic
990557705 5:56952052-56952074 AGGAGCAGCCGGGCTGGAGCGGG - Intronic
993102716 5:83560853-83560875 AGGGTCAGCTTTGATGGTGCTGG - Intronic
993269339 5:85773776-85773798 AGTTAGAGCTTTGCTGGTGCCGG - Intergenic
993667495 5:90718282-90718304 AGGTGCATCTGTGTTGTTACAGG + Intronic
994030411 5:95135476-95135498 AGGTGTATCTGTGAGGGTGCTGG + Intronic
995625898 5:114076259-114076281 AGGGGCAGGTGTGCTGCTGCTGG + Intergenic
995911235 5:117189523-117189545 AGGTGCATCAGTTCTGATGCAGG - Intergenic
996393660 5:122990455-122990477 AAATCCAGCTGTGCTGGAGCTGG + Intronic
997403094 5:133617588-133617610 AAGTGCAGCTGTGTGTGTGCTGG - Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
999178810 5:149654288-149654310 AGGGGCAGGAGTGCTGGTGCAGG + Intergenic
999539018 5:152551291-152551313 AGGTGATGCTATGCTGGTTCTGG - Intergenic
1000362342 5:160459577-160459599 AGTTGCAGCTGTGGTTGAGCAGG + Intergenic
1000614891 5:163415793-163415815 AAGTGCAGATCTGCTGGCGCGGG + Intergenic
1001276232 5:170353723-170353745 AGAGGCAGCTGTGCTGTTCCCGG + Intronic
1002079305 5:176728039-176728061 CGGTGGGGCTGTGCTGGGGCTGG + Intergenic
1002255954 5:177958758-177958780 AGGGGCTGCTGTGTTGCTGCAGG + Intergenic
1002416451 5:179123235-179123257 TGGTGGAGCAGTGGTGGTGCTGG - Intronic
1005435982 6:25812604-25812626 AGATGCATGTGTGCTGTTGCTGG + Intronic
1005843422 6:29759471-29759493 AGGATCTGCTGTGCTGGGGCAGG + Intergenic
1005856840 6:29869185-29869207 AGGTGCAGCTGAGCAGCTGGGGG + Intergenic
1006068216 6:31477788-31477810 AGGATCTGCTGTGCTGGGGCAGG - Intergenic
1006101487 6:31688716-31688738 CGGAGCAGCTGTGCAGGTGAGGG - Exonic
1006271076 6:32968315-32968337 AGGTGCGGCTTCGCTGGTCCTGG - Intronic
1006727685 6:36211502-36211524 GGATGCAGCTGTGCTGGAGCAGG + Exonic
1006797789 6:36742264-36742286 AGGTTCAGATGTGCGTGTGCAGG + Exonic
1007325374 6:41055439-41055461 AGGTGCAGCTGGGTCTGTGCAGG + Intronic
1007992253 6:46269641-46269663 AGCTGCAGCTGTGCAGATACAGG + Intronic
1012189920 6:96266374-96266396 AGGTGGAGCTGTAATGGTGGCGG - Intergenic
1012829383 6:104186526-104186548 AAGTTCACCTCTGCTGGTGCTGG + Intergenic
1013553586 6:111234164-111234186 ATGTGGAGCTGTGCTGGTCATGG - Intergenic
1014098135 6:117482420-117482442 AGGTTCACGTGTACTGGTGCAGG + Intronic
1015148931 6:130018536-130018558 AGGGGAAACTGCGCTGGTGCCGG - Exonic
1016453593 6:144209319-144209341 ACATGCAGTTGTGCTGGTGGTGG + Intergenic
1017004321 6:150019371-150019393 AGGAGCATCTGAGCTGCTGCTGG - Intronic
1017573248 6:155771671-155771693 TGGTGCAGCTTTGCTGGAGTTGG + Intergenic
1017649195 6:156565458-156565480 AGGTTCAGCTGTGGTGTGGCAGG + Intergenic
1019428965 7:989929-989951 AGTGGCACCTGTGCTGGTGGTGG + Intergenic
1019972531 7:4552613-4552635 TGGTGCAGCTTTGCTGGGGGTGG - Intergenic
1020032373 7:4941918-4941940 TGGTGCAACTTTCCTGGTGCTGG + Intronic
1022123063 7:27328838-27328860 GGTAGCAGCTGTGCTGGTGGTGG - Intergenic
1023836946 7:44073986-44074008 CACAGCAGCTGTGCTGGTGCTGG + Exonic
1024639228 7:51316438-51316460 AGGTGGTGCGGTGCTGGTGTTGG - Intronic
1026014563 7:66662930-66662952 ATGTGCAGGTGTGCGTGTGCAGG + Intronic
1027531371 7:79338237-79338259 AGGGGAAGCTTTGCTGTTGCAGG + Intronic
1029310704 7:99660906-99660928 AATTACAGCAGTGCTGGTGCTGG - Intronic
1029333907 7:99883698-99883720 ATGTGCAGATGTCATGGTGCTGG - Intronic
1031901765 7:127418636-127418658 TGGTGTAGTGGTGCTGGTGCTGG - Intronic
1032018001 7:128392136-128392158 GGGTGGGGGTGTGCTGGTGCAGG - Intergenic
1032033232 7:128501903-128501925 AGGTGCCTCTTAGCTGGTGCTGG - Exonic
1033242772 7:139694492-139694514 AGGTGGATCTGGGCTGGGGCAGG - Intronic
1033368748 7:140690568-140690590 AGGTGGAGTTGGGCTTGTGCTGG + Intronic
1033582330 7:142749364-142749386 AGCTGCAGGTGTGTTTGTGCTGG + Intergenic
1033583899 7:142760294-142760316 AGCTGCAGGTGTGTTTGTGCTGG + Intronic
1033585369 7:142770862-142770884 AGCTGCAGGTGTGTTTGTGCTGG + Intergenic
1035341936 7:158167800-158167822 AGGTGCACCCATGCTGATGCTGG + Intronic
1035528858 8:335751-335773 AGGAGCAGCCGTGAAGGTGCAGG + Intergenic
1035770045 8:2139642-2139664 AGCTGCGGCTGTTCTGGAGCTGG + Intronic
1036212162 8:6851248-6851270 ATGTGCAGGTGTGCATGTGCAGG - Intergenic
1037627095 8:20617846-20617868 TGGTGCAGCTCTGCTGGACCTGG + Intergenic
1038309367 8:26434178-26434200 AGGCACTGCTGTGCTGGTGGCGG + Intronic
1038691556 8:29768276-29768298 AGGTGCTGCTGTCCTGCTCCTGG - Intergenic
1039901213 8:41753791-41753813 AGGTGGAGCTGGGATTGTGCTGG - Intronic
1045727895 8:105196784-105196806 ATGTCCTCCTGTGCTGGTGCTGG + Intronic
1046720680 8:117615431-117615453 CAGAGCAGCTGTGCTGGTGGTGG + Intergenic
1047523976 8:125616681-125616703 TGCTGCAGATATGCTGGTGCTGG - Intergenic
1048636968 8:136307306-136307328 ATCTGCAGCTGAGCTGTTGCTGG - Intergenic
1049366368 8:142238768-142238790 AGGGGCAGGTGTGCAGGGGCGGG - Intronic
1049416315 8:142497236-142497258 AGGTTCAGCTGTCCTGGCTCGGG + Intronic
1049419248 8:142509792-142509814 GGGTGCAGCTCTGCAGCTGCAGG - Intronic
1049551449 8:143261800-143261822 AGGTGCAGGGGTGCGGGTGGGGG - Intronic
1049551466 8:143261849-143261871 AGGTGCAGGGGTGCGGGTGCGGG - Intronic
1049551500 8:143261973-143261995 AGGTGCAGGGGTGCGGGTGCGGG - Intronic
1049551528 8:143262063-143262085 AGGTGCAGAGGTGCGGGCGCGGG - Intronic
1049551544 8:143262112-143262134 AGGTGCAGGGGTGCGGGTGTGGG - Intronic
1049758747 8:144322403-144322425 AGGGGCAGATGTGCGTGTGCGGG - Intronic
1051689816 9:19699083-19699105 AGGTGCTTATGTTCTGGTGCTGG + Intronic
1052901073 9:33795452-33795474 AGCTGCAGGTGTGTTTGTGCTGG + Intronic
1053481946 9:38422638-38422660 GGGTGCATCTGTGCTGCCGCTGG - Intronic
1053489126 9:38486841-38486863 GGGGGCAGCTGGGCTGGTCCAGG + Intergenic
1054850931 9:69845984-69846006 AGGTGAAGCTGTGTTTGTGGGGG - Intronic
1056863389 9:90207734-90207756 AGGTTCAGGGGTACTGGTGCAGG + Intergenic
1057274898 9:93670973-93670995 AGGTGCAGCTGTGTCTGTTCAGG + Intronic
1058974714 9:110115178-110115200 TGGTCCAGCAGTGCTGGTCCAGG + Intronic
1060536756 9:124395902-124395924 GGGAGGAGCTGTGCTGGTGTAGG - Intronic
1061163388 9:128909069-128909091 AGGTGAGGCGGTGCAGGTGCTGG - Exonic
1061178216 9:129009764-129009786 AGAAGCAGCTGGGCAGGTGCGGG - Exonic
1061252695 9:129436024-129436046 AGGTTCAGCAGCGCTGGGGCAGG - Intergenic
1061542926 9:131288084-131288106 GGGTCCAGCTGGGCTGGAGCAGG - Intergenic
1061585861 9:131568007-131568029 AGGTGCAGGTGGGCTGAGGCTGG + Intergenic
1061808108 9:133147694-133147716 TGCTGCTGCTGTGCTAGTGCCGG - Intronic
1062423696 9:136496483-136496505 AGGTGCGGCTGTGGTGGTGGTGG + Exonic
1062479632 9:136745332-136745354 AGGGGCCGCTGAGCTGATGCTGG + Intronic
1062635317 9:137487481-137487503 ATGTGCAGCTGTGTCTGTGCAGG + Intronic
1185510581 X:661293-661315 AGGTACAGGTGAGCTGCTGCAGG - Intergenic
1190687486 X:52887876-52887898 AGGTGCTGCTGTCCTGGTGTGGG - Intergenic
1190698496 X:52967916-52967938 AGGTGCTGCTGTCCTGGTGTGGG + Intronic
1193035883 X:76950797-76950819 AGGTGCAGCAAGGCTGGTGGAGG + Intergenic
1193494330 X:82191911-82191933 AGGTTCAGGTGTGCATGTGCAGG + Intergenic
1193532594 X:82674458-82674480 AAGTGCAGCTGAGTTGTTGCAGG + Intergenic
1194055438 X:89126781-89126803 GGGTGCAGTTGTACTGGTGGTGG + Intergenic
1196857384 X:119996905-119996927 AGGAGCTGCAGAGCTGGTGCGGG - Intergenic
1197316990 X:124979102-124979124 AGGTTCTGCTGTGGTGGGGCAGG - Intergenic
1199724338 X:150566606-150566628 AGGTGGGGCTGGGCTGGGGCTGG + Intergenic
1200092625 X:153643009-153643031 AGGGGGAGCTATGTTGGTGCAGG - Intronic
1201892226 Y:18955141-18955163 AGGTTCAGCAGTGCATGTGCAGG - Intergenic