ID: 951733430

View in Genome Browser
Species Human (GRCh38)
Location 3:25836446-25836468
Sequence GTGTTGGGGAACATGAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951733430_951733435 -9 Left 951733430 3:25836446-25836468 CCCCAGCTCATGTTCCCCAACAC No data
Right 951733435 3:25836460-25836482 CCCCAACACAAACAATGGTTTGG No data
951733430_951733439 23 Left 951733430 3:25836446-25836468 CCCCAGCTCATGTTCCCCAACAC No data
Right 951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG No data
951733430_951733438 22 Left 951733430 3:25836446-25836468 CCCCAGCTCATGTTCCCCAACAC No data
Right 951733438 3:25836491-25836513 CATGAACAAAACTGCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951733430 Original CRISPR GTGTTGGGGAACATGAGCTG GGG (reversed) Intergenic
No off target data available for this crispr