ID: 951733432

View in Genome Browser
Species Human (GRCh38)
Location 3:25836448-25836470
Sequence TTGTGTTGGGGAACATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951733432_951733439 21 Left 951733432 3:25836448-25836470 CCAGCTCATGTTCCCCAACACAA No data
Right 951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG No data
951733432_951733440 29 Left 951733432 3:25836448-25836470 CCAGCTCATGTTCCCCAACACAA No data
Right 951733440 3:25836500-25836522 AACTGCCTTTGTGGGAGCTTTGG No data
951733432_951733441 30 Left 951733432 3:25836448-25836470 CCAGCTCATGTTCCCCAACACAA No data
Right 951733441 3:25836501-25836523 ACTGCCTTTGTGGGAGCTTTGGG No data
951733432_951733438 20 Left 951733432 3:25836448-25836470 CCAGCTCATGTTCCCCAACACAA No data
Right 951733438 3:25836491-25836513 CATGAACAAAACTGCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951733432 Original CRISPR TTGTGTTGGGGAACATGAGC TGG (reversed) Intergenic
No off target data available for this crispr