ID: 951733437

View in Genome Browser
Species Human (GRCh38)
Location 3:25836462-25836484
Sequence TGCCAAACCATTGTTTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951733437_951733441 16 Left 951733437 3:25836462-25836484 CCAACACAAACAATGGTTTGGCA No data
Right 951733441 3:25836501-25836523 ACTGCCTTTGTGGGAGCTTTGGG No data
951733437_951733440 15 Left 951733437 3:25836462-25836484 CCAACACAAACAATGGTTTGGCA No data
Right 951733440 3:25836500-25836522 AACTGCCTTTGTGGGAGCTTTGG No data
951733437_951733439 7 Left 951733437 3:25836462-25836484 CCAACACAAACAATGGTTTGGCA No data
Right 951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG No data
951733437_951733443 30 Left 951733437 3:25836462-25836484 CCAACACAAACAATGGTTTGGCA No data
Right 951733443 3:25836515-25836537 AGCTTTGGGATCCAGATAAGAGG No data
951733437_951733438 6 Left 951733437 3:25836462-25836484 CCAACACAAACAATGGTTTGGCA No data
Right 951733438 3:25836491-25836513 CATGAACAAAACTGCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951733437 Original CRISPR TGCCAAACCATTGTTTGTGT TGG (reversed) Intergenic
No off target data available for this crispr