ID: 951733439

View in Genome Browser
Species Human (GRCh38)
Location 3:25836492-25836514
Sequence ATGAACAAAACTGCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951733432_951733439 21 Left 951733432 3:25836448-25836470 CCAGCTCATGTTCCCCAACACAA No data
Right 951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG No data
951733437_951733439 7 Left 951733437 3:25836462-25836484 CCAACACAAACAATGGTTTGGCA No data
Right 951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG No data
951733436_951733439 8 Left 951733436 3:25836461-25836483 CCCAACACAAACAATGGTTTGGC No data
Right 951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG No data
951733430_951733439 23 Left 951733430 3:25836446-25836468 CCCCAGCTCATGTTCCCCAACAC No data
Right 951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG No data
951733434_951733439 9 Left 951733434 3:25836460-25836482 CCCCAACACAAACAATGGTTTGG No data
Right 951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG No data
951733431_951733439 22 Left 951733431 3:25836447-25836469 CCCAGCTCATGTTCCCCAACACA No data
Right 951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951733439 Original CRISPR ATGAACAAAACTGCCTTTGT GGG Intergenic
No off target data available for this crispr