ID: 951736686

View in Genome Browser
Species Human (GRCh38)
Location 3:25873982-25874004
Sequence GTAAAGCCAAGCCCAGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951736686 Original CRISPR GTAAAGCCAAGCCCAGAGTA AGG Intergenic
900626281 1:3610170-3610192 GTAAAGCCAGACCCAGGGTGGGG + Intronic
903536017 1:24066899-24066921 GATCAGCCAAGCACAGAGTATGG + Intronic
903585554 1:24413240-24413262 GTAAATCGAGGCCCAGAGCAGGG + Intronic
904804450 1:33120811-33120833 TTAAGGCCTGGCCCAGAGTAGGG + Intergenic
905653223 1:39670386-39670408 TTAAAGCAAAGCTCAGAATAAGG - Intronic
905884181 1:41482841-41482863 GCCAAGCCAGGCCCAGAGAAGGG - Intronic
906963638 1:50435279-50435301 TTAAATCCAAGCCAAGAGTTTGG + Intergenic
910852447 1:91662194-91662216 ATAAAACCAAGCCCAGTGTTTGG + Intergenic
911396063 1:97311917-97311939 GAAAAGCAAAGCAAAGAGTAGGG + Intronic
912238001 1:107873617-107873639 TGAAAGCCAAGCCCCTAGTAAGG - Intronic
913957404 1:143318475-143318497 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
914051718 1:144143839-144143861 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
914127479 1:144822702-144822724 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
916778775 1:167999741-167999763 CTAAAGCCTAACCCAGAGCAAGG - Intronic
916796290 1:168170564-168170586 GTACAGGCAAGCCCAGTGGATGG - Intergenic
918106525 1:181420004-181420026 GTAAATCCAAGCCCTGGGAAAGG - Intronic
918373003 1:183880627-183880649 GTCAAGCCAGGCCCTTAGTATGG - Exonic
919989657 1:202700382-202700404 GTGAAGCCCAGCCCAGAGCCGGG - Intronic
923128912 1:231057730-231057752 GTAAAGTCAAGCCCAAAGGTGGG + Intergenic
923606760 1:235451109-235451131 GGAAGGCCAAGCCCAGGGTCAGG + Intronic
924831736 1:247603063-247603085 ATAAAGCCCAACCCAGAGTTAGG - Intergenic
1062890185 10:1053434-1053456 ATAAAGCCTAATCCAGAGTAAGG - Intronic
1065696101 10:28381125-28381147 GTAAAGCCCAGTCCAGAGACAGG + Intergenic
1066759478 10:38738949-38738971 ACAAAGCCAGGCCCAGAGCAGGG - Intergenic
1066961353 10:42230671-42230693 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1066962141 10:42233812-42233834 ACAAAGCCAGGCCCAGAGCAGGG + Intergenic
1069117833 10:64530147-64530169 GTAAATCCTGGCCCAGAGAAAGG + Intergenic
1071330091 10:84550321-84550343 GGAAACCGAAGCCCAGAGTCAGG - Intergenic
1074401764 10:113147282-113147304 GGGAAGCCAAGACCAGAGAAGGG + Intronic
1075646709 10:124101522-124101544 GTAAAGCAAATCCCTGAGCATGG - Intergenic
1075989715 10:126825393-126825415 GTAAATCCCTGCCTAGAGTAGGG - Intergenic
1076474365 10:130742207-130742229 GTAAACCCACGCCCAGAATCAGG - Intergenic
1077262660 11:1631137-1631159 GTAAATCCAAGCTCACAGTCTGG + Intergenic
1078276611 11:9854503-9854525 GTAAAGCTAAGCAGAGACTATGG + Intronic
1080901700 11:36499719-36499741 ATTAAGCCAAGTCCCGAGTATGG + Intronic
1081071529 11:38616242-38616264 CTAAAGCCTAACCCAGAGCAAGG - Intergenic
1081772990 11:45661240-45661262 GAGAAGGCAAGCCCAGAGGAAGG + Intronic
1086187171 11:84032415-84032437 CTAAAGCCTAACCCAGAGCAAGG + Intronic
1087789759 11:102393561-102393583 GTAAAGCCACTGCCATAGTAAGG - Intergenic
1089247460 11:117132707-117132729 ATAAAGACAAGTCCAGAGTATGG + Intergenic
1089784165 11:120896066-120896088 CCAAAGCCAGGCCCAGAGCAAGG + Intronic
1090894904 11:130963651-130963673 GAAAGGCAAAGCCCAGTGTAAGG - Intergenic
1091066676 11:132520125-132520147 GGAAAGGCAAGGCAAGAGTATGG + Intronic
1091425818 12:388856-388878 GTAAAGCTAAACCCAGTGTACGG + Intronic
1091595874 12:1878852-1878874 GGCAAGCCAAGCCCAGAGCTGGG - Intronic
1094149015 12:27261438-27261460 GGAAACCCATGCCCAGAATATGG - Intronic
1094172219 12:27505603-27505625 CTAAGGCCAAGTCCAAAGTAGGG - Intergenic
1096332739 12:50728638-50728660 GCGAAGCCAAGTCCACAGTAAGG - Exonic
1096470150 12:51870440-51870462 GCAAAGCCAAGGCCAGAGGTGGG - Intergenic
1098684790 12:73405348-73405370 ATAAAGCTAAGCTCAGAATAAGG + Intergenic
1098914034 12:76239080-76239102 GTGAGGCCTAGCCCAGAGTGAGG - Intergenic
1102008030 12:109601190-109601212 GTAAACTGAGGCCCAGAGTAGGG + Intergenic
1106610647 13:31276240-31276262 GTAAGGCCAGGCCCAGAAAAGGG + Intronic
1108934765 13:55870563-55870585 GCCAAGCAAAGCCCAGAGAAAGG - Intergenic
1109326990 13:60879675-60879697 GTGAAGTCAAGGACAGAGTAGGG + Intergenic
1111518459 13:89366157-89366179 GTAATTCCAAGCACATAGTAAGG - Intergenic
1112216497 13:97435205-97435227 GTAAAGTCAAGTCCAGAGGAAGG + Intronic
1112216994 13:97441664-97441686 GCAAAGAAAACCCCAGAGTAAGG - Intronic
1112575767 13:100635170-100635192 GAAATCCCAGGCCCAGAGTAAGG + Exonic
1115179005 14:30600288-30600310 GGAACCCCTAGCCCAGAGTAGGG - Intronic
1115514288 14:34169740-34169762 GTACAGCAAAGGCCAAAGTATGG - Intronic
1115568446 14:34645413-34645435 CCAAAGCCTAACCCAGAGTAAGG - Intergenic
1115921331 14:38377646-38377668 GTGCAGCCATACCCAGAGTATGG + Intergenic
1118703149 14:68454670-68454692 ATAAAGACAAGCCCTGAGAATGG - Intronic
1119432920 14:74579933-74579955 GTAAATACATGCCCAGAGTATGG - Intronic
1121347845 14:93149330-93149352 GGAAAGCAAAGCCCAGAGGTGGG + Intergenic
1121968741 14:98336368-98336390 GAAAAGCCAAGCTCAGAGGGAGG + Intergenic
1202930978 14_KI270725v1_random:31615-31637 GCAAAGCCAAGGCCAGTGCAGGG - Intergenic
1123421463 15:20140108-20140130 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1123443670 15:20306712-20306734 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1123530689 15:21146648-21146670 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1125780262 15:42259456-42259478 ATAAAGACAAGCCCTGAGAATGG - Intronic
1126461995 15:48924284-48924306 TTAAAGCTAAGCCCAAAGCAAGG - Intronic
1126844851 15:52749317-52749339 GTAAAGCTTAGCCCAGTGTCCGG - Intergenic
1128024987 15:64427997-64428019 GTAAAGCCTACACCAGTGTAAGG - Intronic
1128354488 15:66915350-66915372 TCAGAGCCAAGCCCAGAGTTGGG + Intergenic
1128359767 15:66953867-66953889 GTTAAGCCCAGCCCAGAGTTGGG - Intergenic
1129779393 15:78260192-78260214 GTAGAGGCAAGCCCAGAGAGAGG - Intergenic
1132032379 15:98449177-98449199 TCAAAGCCTAACCCAGAGTAAGG - Intronic
1132473075 16:117769-117791 GGACAGCCAAGCCCTGAGCAGGG + Intronic
1134080986 16:11324854-11324876 GTCCAGCCAAGCACATAGTAGGG - Intronic
1134406215 16:13961083-13961105 GAAAAGCCCAGCCCATAGTTTGG + Intergenic
1135565103 16:23505902-23505924 GTAAAGAAAGTCCCAGAGTAGGG - Intronic
1136669108 16:31839803-31839825 GTCCAGCCAAGCCCAGAGCCAGG + Intergenic
1136722540 16:32337179-32337201 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1136723306 16:32340214-32340236 ACAAAGCCAGGCCCAGAGCAGGG + Intergenic
1136773626 16:32860117-32860139 ACAAAGCCAGGCCCAGAGCAGGG - Intergenic
1136840864 16:33543172-33543194 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1136841650 16:33546292-33546314 ACAAAGCCAGGCCCAGAGCAGGG + Intergenic
1136896987 16:34001402-34001424 ACAAAGCCAGGCCCAGAGCAGGG + Intergenic
1138225997 16:55295131-55295153 GTAAAGCCCAGCACAGTGTCTGG - Intergenic
1142032874 16:87847135-87847157 GTGAAGCCAGGCCCAGAAGAAGG + Intronic
1203003126 16_KI270728v1_random:177551-177573 ACAAAGCCAGGCCCAGAGCAGGG - Intergenic
1203003891 16_KI270728v1_random:180585-180607 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1203076042 16_KI270728v1_random:1122228-1122250 ACAAAGCCAGGCCCAGAGCAGGG - Intergenic
1203134731 16_KI270728v1_random:1713957-1713979 ACAAAGCCAGGCCCAGAGCAGGG - Intergenic
1203135499 16_KI270728v1_random:1716992-1717014 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1203151029 16_KI270728v1_random:1843469-1843491 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1203151815 16_KI270728v1_random:1846589-1846611 ACAAAGCCAGGCCCAGAGCAGGG + Intergenic
1144256701 17:13475549-13475571 TTATAGCCATTCCCAGAGTAGGG + Intergenic
1146488747 17:33264720-33264742 GGAAACCCAAGCCCAGAGAAGGG - Intronic
1149171870 17:53821921-53821943 GACAGGCCAAGCTCAGAGTAAGG - Intergenic
1150004258 17:61460105-61460127 GTAAACCAAACCCCAGAGAAGGG + Intronic
1151521624 17:74634508-74634530 CTAAGGCCAGGCCCAGAGTTGGG + Intergenic
1203172521 17_GL000205v2_random:162322-162344 AGAAGGCCAAGCCCAGAGGAGGG - Intergenic
1203173198 17_GL000205v2_random:170456-170478 AGAAGGCCAAGCCCAGAGGAGGG + Intergenic
1153053400 18:921911-921933 GTAGAGGGAAGCCCAAAGTAAGG + Intergenic
1153473488 18:5471337-5471359 CTAAAGCCACACGCAGAGTAAGG + Intronic
1154311064 18:13266447-13266469 GGAAAGCCAAGCCCAGGGTTGGG - Intronic
1154414648 18:14170587-14170609 CTAAGGCCATGCCCAGAGCAGGG + Intergenic
1154415174 18:14172343-14172365 ACAAAGCCAGGCCCAGAGCAGGG + Intergenic
1157349583 18:46872667-46872689 GTAAAGGCAAGCCAAGGATAAGG + Intronic
1158045488 18:53150193-53150215 GAAAAACCAAGCTCAGAGGAAGG - Intronic
1160688132 19:446804-446826 GTAAACCGAAGCCCAGAGAGGGG + Intronic
1161425865 19:4202777-4202799 GTATAGCAGAGCCCAGGGTAGGG + Intronic
1162958548 19:14113140-14113162 GTAGAGCCAAGCACAGGGCAAGG - Intronic
1164834181 19:31346942-31346964 GTAAATCCAAAACCCGAGTATGG + Intronic
1165104749 19:33462243-33462265 GGAAAGGAAAGCCCAGAGTGAGG + Intronic
1166075204 19:40410217-40410239 GTGAGGACAAGCCCAGAGTCGGG - Intronic
1166225207 19:41390815-41390837 GGAAAGTGAAGCCCAGAGGAAGG - Intronic
1202691114 1_KI270712v1_random:96263-96285 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
925328111 2:3038479-3038501 ATAAAGCCAGGCGCACAGTAGGG - Intergenic
925700765 2:6635492-6635514 AAACAGCCAAACCCAGAGTAAGG - Intergenic
926280776 2:11443997-11444019 GTGAAGCCAGGTCCAGAATAGGG + Intergenic
928439821 2:31283140-31283162 GTAAAGCCAAGGCCACAGGCTGG + Intergenic
928677676 2:33665609-33665631 TTAAAGCCAAGCCCAGACATGGG - Intergenic
928777567 2:34784118-34784140 GTAAATCCAAGCCAGGAGTTTGG - Intergenic
929687836 2:44049652-44049674 GTAAAGGCAAGGCCACCGTAGGG + Intergenic
929915399 2:46131497-46131519 GTAAAGAAATGTCCAGAGTATGG + Intronic
933955279 2:87357688-87357710 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
934239467 2:90253901-90253923 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
934273718 2:91562797-91562819 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
934322798 2:91983300-91983322 ACAAAGCCAGGCCCAGAGCAGGG - Intergenic
934323566 2:91986422-91986444 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
934461911 2:94217255-94217277 GCAAAGCCAAGGCCAGGGTAGGG - Intergenic
934949971 2:98569595-98569617 GTAGAGCCCAGCCCAGTGTCTGG - Intronic
940756609 2:157690115-157690137 GCAAAGCCTAATCCAGAGTAAGG - Intergenic
941499355 2:166250584-166250606 AAAAATACAAGCCCAGAGTAGGG - Intronic
942012989 2:171782759-171782781 GAAAAGCAAAGCAAAGAGTAGGG + Intergenic
944926272 2:204468019-204468041 GTAAAGCCATGGCCAAAGCAGGG + Intergenic
945646819 2:212506628-212506650 CTAAAGCCTAACCCAGAGAAAGG + Intronic
1169613948 20:7417439-7417461 GTAAGGCCAAGCCCACAGACTGG + Intergenic
1169838293 20:9905365-9905387 GTAAGTCCAGGCCCAGAGTGAGG - Intergenic
1171248668 20:23632983-23633005 TTAAATCCAAGTCCAGAGAAAGG + Intronic
1171271597 20:23822530-23822552 TTAAATCCAAGTCCAGAGAAAGG + Intergenic
1172885718 20:38229586-38229608 ATGAAGCCAAGCCCAGAGCAGGG + Intronic
1175518936 20:59587398-59587420 GGAAAGCCAGGCTCAGAGAAGGG - Intronic
1176592999 21:8660237-8660259 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1176858376 21:13987667-13987689 CTAAGGCCATGCCCAGAGCAGGG - Intergenic
1178350892 21:31872812-31872834 GAAAACCCAAGCCCAGAATCCGG + Intergenic
1180247334 21:46557029-46557051 GCAAAACCAAGGCCACAGTAGGG - Exonic
1180275846 22:10637364-10637386 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1180550333 22:16532309-16532331 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1181354339 22:22289514-22289536 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1182838564 22:33364478-33364500 GAAAAGCAAAACCCCGAGTAAGG - Intronic
1183587405 22:38760863-38760885 AAAAAGCCAAGACCAGAGCAGGG - Intronic
1184386420 22:44178315-44178337 AGAAAGCCAAGACCAGGGTAGGG - Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
950532235 3:13558846-13558868 TTAAAGCCAAGCCCTGAGGGTGG - Intronic
951066072 3:18267099-18267121 CTAAAACCAATCCTAGAGTATGG + Intronic
951722452 3:25715104-25715126 GAAAACTCAAGCCCAGAGAAGGG - Intergenic
951736686 3:25873982-25874004 GTAAAGCCAAGCCCAGAGTAAGG + Intergenic
952265879 3:31785845-31785867 CTAAAGCCATGCTCAGAGTAAGG - Intronic
952729029 3:36619694-36619716 GTCACACCAAGCCGAGAGTAGGG - Intergenic
953262921 3:41357629-41357651 GCAGAGCCTAGCACAGAGTAGGG + Intronic
953697748 3:45172954-45172976 GTGAATCCATGCCCACAGTATGG + Intergenic
954313446 3:49787357-49787379 CTGAAGCCAAGCCCAGAGTTAGG - Intergenic
961569434 3:127787294-127787316 GTCCAGCCAAGTCCAGAGTCTGG - Intronic
965144849 3:164888962-164888984 GTACAAGCAAGCCCAGACTATGG - Intergenic
965610497 3:170538598-170538620 GTAAAGCCAAGAGTAGAGTGAGG - Intronic
967866678 3:194195742-194195764 GTAAACCCAAGTCAAGAGTCTGG - Intergenic
968698550 4:2044034-2044056 GGAAACCCAAGCCCAGAGAGGGG - Intergenic
970528812 4:16961094-16961116 CTAAAGCCTAGTCCAGAGAAAGG + Intergenic
970909167 4:21254578-21254600 GTAAGGCAAAGTCCAAAGTAGGG - Intronic
975641393 4:76503967-76503989 ATAAAGCCAAGACCAGGGAAAGG - Intronic
976556311 4:86454331-86454353 GAAAGGCGAAGCCCAGTGTAAGG + Intronic
977733333 4:100380703-100380725 GTAAGGCAAAGCCCAGTGCAAGG + Intergenic
978250911 4:106630695-106630717 GTTAAGCCAATCCCCTAGTAAGG - Intergenic
978861255 4:113451826-113451848 GGGAAGGCAAGCCCAGAATAGGG + Intronic
987529407 5:19098010-19098032 CTAAAGCCTAATCCAGAGTAAGG + Intergenic
987952544 5:24694037-24694059 GAAAAGCCTACTCCAGAGTATGG + Intergenic
991413115 5:66364936-66364958 CCAAAGCCTAGCCCAGAGCAAGG - Intergenic
995320590 5:110829484-110829506 TTAAAGCCAAGCCCAGACATGGG - Intergenic
996019419 5:118575532-118575554 ATAAAGCCAGACCCAGAGAAAGG + Intergenic
996532921 5:124544948-124544970 GTGAAGCCAAACCCAGAAGAAGG + Intergenic
997717009 5:136049881-136049903 GAATAGCCAAGGCCAGAGCAAGG + Intronic
998300349 5:141012750-141012772 GGAAGGCCAAGGCCAGAGGATGG + Intergenic
999730341 5:154472850-154472872 GAAAAGCCGAGCACAGAGAACGG - Intergenic
1000547247 5:162618537-162618559 GAGAAGCAAAGCACAGAGTATGG + Intergenic
1001166744 5:169375283-169375305 GAAAGGCAAAGCCCAGAGTAAGG + Intergenic
1001771492 5:174300400-174300422 GTAAAGCCAACCTCAGTGGAAGG - Intergenic
1002495082 5:179606327-179606349 CTCAAGCCAAGCCCTGAGTTGGG + Intronic
1003116834 6:3288981-3289003 GTAAAGACAGGCCCAGGGTGAGG - Intronic
1010923564 6:81715139-81715161 GTAAAGCCAAGGACAGCATAAGG + Intronic
1012208252 6:96488672-96488694 GAAAAGTGAAGCCCAGTGTAAGG - Intergenic
1013139039 6:107312408-107312430 GTATAGCTAAGCTAAGAGTATGG + Intronic
1018713231 6:166512700-166512722 GGAAACCAAAGCCAAGAGTAGGG - Intronic
1019316812 7:390777-390799 GCAAAGCCAAGCTCAGAGCCTGG + Intergenic
1021163890 7:17309937-17309959 GTAAAGCCAATCCCAGCTGAAGG + Exonic
1021662704 7:22936172-22936194 TTAAAGCCAGATCCAGAGTAAGG + Intergenic
1021836212 7:24678089-24678111 ATCCAGCAAAGCCCAGAGTAAGG + Intronic
1024002363 7:45199121-45199143 GCAAAGCCAAGTCCAGGGAATGG - Intergenic
1024304599 7:47917042-47917064 GAAAGGCAAAGCCCAGTGTAAGG + Intronic
1025028567 7:55537448-55537470 GTGAAGCCTGGCCCAGAGTTTGG - Intronic
1028972380 7:96873468-96873490 GTACAGACAAGCCCAGACTGTGG - Intergenic
1029453355 7:100655193-100655215 GAAAGGCCAAGCCCAAAGGAGGG + Intronic
1032880091 7:136079894-136079916 GTAAGGTAAAGCCAAGAGTAAGG - Intergenic
1035555569 8:564865-564887 GTAAAGCCAGACCCAGGGTCAGG + Intergenic
1036752348 8:11451247-11451269 GCAAAGCCAAGCCGACAGTGTGG + Intronic
1036850008 8:12194516-12194538 CTAAGGCCAGGCCCAGAGAAGGG + Intergenic
1036871370 8:12436789-12436811 CTAAGGCCAGGCCCAGAGAAGGG + Intergenic
1039076768 8:33697424-33697446 CCAAAGCCAAGTCCAGAGCAAGG - Intergenic
1039391796 8:37187151-37187173 GGAAAGGCAACCTCAGAGTAGGG - Intergenic
1041469021 8:58188225-58188247 GCAAAGGGAAGCCTAGAGTATGG + Intronic
1043950619 8:86305233-86305255 TTAAAGCCAAGCCAAAATTAAGG + Intronic
1045211396 8:100103793-100103815 GTGAAACCAAGCCAAGAGAAAGG + Intronic
1048359980 8:133689408-133689430 GTAAAGTGAAGCCCAGAGAGAGG + Intergenic
1050129178 9:2392460-2392482 GTGAAGACATGCCCAGACTATGG + Intergenic
1053692394 9:40592939-40592961 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1054272422 9:63044594-63044616 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1054303636 9:63393857-63393879 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1054402414 9:64720367-64720389 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1054436024 9:65204698-65204720 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1054494368 9:65816989-65817011 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1056253416 9:84773827-84773849 ACAAAACCAAGCACAGAGTAGGG - Intronic
1058355435 9:104078650-104078672 TTAAAGCCAAGCCCAGACATGGG + Intergenic
1058481142 9:105396585-105396607 GTCAAGCCCAGCCCAGCATATGG + Exonic
1058674167 9:107386534-107386556 GTAATGCCAAGGGCTGAGTAGGG + Intergenic
1059443334 9:114323294-114323316 GGAAAGGGAAGCCCAGAGAAGGG - Intronic
1059444526 9:114330065-114330087 GTAAAGGGAAGCCCAGAGAAGGG - Intronic
1060028174 9:120190689-120190711 GGAAAACCAAGCCCAGAGAAGGG + Intergenic
1060047462 9:120352004-120352026 GGAATGCCCAGCCCAGAGTAGGG + Intergenic
1060532151 9:124354187-124354209 GAAATGACAAGCCCAGAGTCTGG - Intronic
1203623045 Un_KI270749v1:139044-139066 GCAAAGCCAAGGCCAGTGCAGGG - Intergenic
1185810466 X:3104322-3104344 AATAAGCCAAGCCCAGAGAAAGG - Intronic
1185847812 X:3455953-3455975 GTAAAAGCAAGCCCAGGATAGGG + Intergenic
1185915414 X:4029096-4029118 GCAAAGTCCAGTCCAGAGTACGG + Intergenic
1189827864 X:44938402-44938424 CCAAAGCCAAACCCAGAGCAAGG + Intronic
1192193639 X:69014534-69014556 GGAAAGTGAGGCCCAGAGTAGGG + Intergenic
1192497677 X:71626959-71626981 GTAAAGTCCAGCCCAGAGTCAGG - Intergenic
1195480655 X:105340777-105340799 GAAAAGCCTAGATCAGAGTAAGG - Intronic
1196530746 X:116783290-116783312 GAAAGGCCAAGCCCAATGTAAGG + Intergenic
1196735481 X:118977628-118977650 GGAAAATCAAGCCCAGAGAAGGG - Intronic
1198614738 X:138444476-138444498 GGAAATCCAACCCCAGATTATGG - Intergenic
1199201967 X:145102046-145102068 GAAAGGCAAAGCCCAGTGTAAGG - Intergenic
1199486933 X:148358550-148358572 GTAAAGCAAAACCCAGAGTGTGG - Intergenic
1199663731 X:150080388-150080410 GCCAAGCCTAGCCCAGAGTCAGG - Intergenic
1199783371 X:151082983-151083005 GTAACCCCAAGCCCAGACTACGG + Intergenic
1201190979 Y:11441408-11441430 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1202583330 Y:26403439-26403461 ACAAAGCCAGGCCCAGAGCAGGG + Intergenic