ID: 951742646

View in Genome Browser
Species Human (GRCh38)
Location 3:25941384-25941406
Sequence CACCTACCCATTGTTCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951742646_951742649 15 Left 951742646 3:25941384-25941406 CCCTGGGGAACAATGGGTAGGTG No data
Right 951742649 3:25941422-25941444 AAAGCACAAAAGACAAATAGAGG No data
951742646_951742648 -10 Left 951742646 3:25941384-25941406 CCCTGGGGAACAATGGGTAGGTG No data
Right 951742648 3:25941397-25941419 TGGGTAGGTGAGCAACTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951742646 Original CRISPR CACCTACCCATTGTTCCCCA GGG (reversed) Intergenic
No off target data available for this crispr