ID: 951742648

View in Genome Browser
Species Human (GRCh38)
Location 3:25941397-25941419
Sequence TGGGTAGGTGAGCAACTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951742646_951742648 -10 Left 951742646 3:25941384-25941406 CCCTGGGGAACAATGGGTAGGTG No data
Right 951742648 3:25941397-25941419 TGGGTAGGTGAGCAACTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951742648 Original CRISPR TGGGTAGGTGAGCAACTCAC AGG Intergenic
No off target data available for this crispr