ID: 951748065

View in Genome Browser
Species Human (GRCh38)
Location 3:26001430-26001452
Sequence GCTGATAAGCAACTACTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951748065_951748069 5 Left 951748065 3:26001430-26001452 CCTAGCAGTAGTTGCTTATCAGC No data
Right 951748069 3:26001458-26001480 AAGCTTTTGGGTGAGACAATGGG No data
951748065_951748070 6 Left 951748065 3:26001430-26001452 CCTAGCAGTAGTTGCTTATCAGC No data
Right 951748070 3:26001459-26001481 AGCTTTTGGGTGAGACAATGGGG No data
951748065_951748068 4 Left 951748065 3:26001430-26001452 CCTAGCAGTAGTTGCTTATCAGC No data
Right 951748068 3:26001457-26001479 GAAGCTTTTGGGTGAGACAATGG No data
951748065_951748066 -8 Left 951748065 3:26001430-26001452 CCTAGCAGTAGTTGCTTATCAGC No data
Right 951748066 3:26001445-26001467 TTATCAGCTTAAGAAGCTTTTGG 0: 464
1: 932
2: 11404
3: 5407
4: 2133
951748065_951748067 -7 Left 951748065 3:26001430-26001452 CCTAGCAGTAGTTGCTTATCAGC No data
Right 951748067 3:26001446-26001468 TATCAGCTTAAGAAGCTTTTGGG 0: 376
1: 887
2: 11188
3: 5245
4: 2615
951748065_951748071 20 Left 951748065 3:26001430-26001452 CCTAGCAGTAGTTGCTTATCAGC No data
Right 951748071 3:26001473-26001495 ACAATGGGGTTTCTAGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951748065 Original CRISPR GCTGATAAGCAACTACTGCT AGG (reversed) Intergenic
No off target data available for this crispr