ID: 951748965 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:26012618-26012640 |
| Sequence | CAGATCAGCCAGAAGGTGTG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 951748965_951748968 | 8 | Left | 951748965 | 3:26012618-26012640 | CCGCACACCTTCTGGCTGATCTG | No data | ||
| Right | 951748968 | 3:26012649-26012671 | TCAGTTCAGAATCCATTAACTGG | No data | ||||
| 951748965_951748969 | 17 | Left | 951748965 | 3:26012618-26012640 | CCGCACACCTTCTGGCTGATCTG | No data | ||
| Right | 951748969 | 3:26012658-26012680 | AATCCATTAACTGGAGATTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 951748965 | Original CRISPR | CAGATCAGCCAGAAGGTGTG CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||