ID: 951748965

View in Genome Browser
Species Human (GRCh38)
Location 3:26012618-26012640
Sequence CAGATCAGCCAGAAGGTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951748965_951748968 8 Left 951748965 3:26012618-26012640 CCGCACACCTTCTGGCTGATCTG No data
Right 951748968 3:26012649-26012671 TCAGTTCAGAATCCATTAACTGG No data
951748965_951748969 17 Left 951748965 3:26012618-26012640 CCGCACACCTTCTGGCTGATCTG No data
Right 951748969 3:26012658-26012680 AATCCATTAACTGGAGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951748965 Original CRISPR CAGATCAGCCAGAAGGTGTG CGG (reversed) Intergenic
No off target data available for this crispr