ID: 951749088

View in Genome Browser
Species Human (GRCh38)
Location 3:26013922-26013944
Sequence CCATATCTGCTAGGTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951749088_951749097 18 Left 951749088 3:26013922-26013944 CCTGCCACACCTAGCAGATATGG No data
Right 951749097 3:26013963-26013985 TGACCTGCCATGGGTATCCTAGG No data
951749088_951749095 9 Left 951749088 3:26013922-26013944 CCTGCCACACCTAGCAGATATGG No data
Right 951749095 3:26013954-26013976 GTTACATCCTGACCTGCCATGGG No data
951749088_951749098 19 Left 951749088 3:26013922-26013944 CCTGCCACACCTAGCAGATATGG No data
Right 951749098 3:26013964-26013986 GACCTGCCATGGGTATCCTAGGG No data
951749088_951749094 8 Left 951749088 3:26013922-26013944 CCTGCCACACCTAGCAGATATGG No data
Right 951749094 3:26013953-26013975 GGTTACATCCTGACCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951749088 Original CRISPR CCATATCTGCTAGGTGTGGC AGG (reversed) Intergenic