ID: 951749091

View in Genome Browser
Species Human (GRCh38)
Location 3:26013926-26013948
Sequence TAGCCCATATCTGCTAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951749091_951749097 14 Left 951749091 3:26013926-26013948 CCACACCTAGCAGATATGGGCTA No data
Right 951749097 3:26013963-26013985 TGACCTGCCATGGGTATCCTAGG No data
951749091_951749095 5 Left 951749091 3:26013926-26013948 CCACACCTAGCAGATATGGGCTA No data
Right 951749095 3:26013954-26013976 GTTACATCCTGACCTGCCATGGG No data
951749091_951749098 15 Left 951749091 3:26013926-26013948 CCACACCTAGCAGATATGGGCTA No data
Right 951749098 3:26013964-26013986 GACCTGCCATGGGTATCCTAGGG No data
951749091_951749094 4 Left 951749091 3:26013926-26013948 CCACACCTAGCAGATATGGGCTA No data
Right 951749094 3:26013953-26013975 GGTTACATCCTGACCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951749091 Original CRISPR TAGCCCATATCTGCTAGGTG TGG (reversed) Intergenic
No off target data available for this crispr