ID: 951749098

View in Genome Browser
Species Human (GRCh38)
Location 3:26013964-26013986
Sequence GACCTGCCATGGGTATCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951749088_951749098 19 Left 951749088 3:26013922-26013944 CCTGCCACACCTAGCAGATATGG No data
Right 951749098 3:26013964-26013986 GACCTGCCATGGGTATCCTAGGG No data
951749092_951749098 10 Left 951749092 3:26013931-26013953 CCTAGCAGATATGGGCTAAGAAG No data
Right 951749098 3:26013964-26013986 GACCTGCCATGGGTATCCTAGGG No data
951749091_951749098 15 Left 951749091 3:26013926-26013948 CCACACCTAGCAGATATGGGCTA No data
Right 951749098 3:26013964-26013986 GACCTGCCATGGGTATCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951749098 Original CRISPR GACCTGCCATGGGTATCCTA GGG Intergenic