ID: 951749220

View in Genome Browser
Species Human (GRCh38)
Location 3:26015241-26015263
Sequence GCAGCCTTTGGGACTTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951749214_951749220 17 Left 951749214 3:26015201-26015223 CCATTCACTTACACAATTAAAAG No data
Right 951749220 3:26015241-26015263 GCAGCCTTTGGGACTTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951749220 Original CRISPR GCAGCCTTTGGGACTTGTAC TGG Intergenic