ID: 951752155

View in Genome Browser
Species Human (GRCh38)
Location 3:26048442-26048464
Sequence CACTAAGAATGGAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951752155_951752163 1 Left 951752155 3:26048442-26048464 CCCCCTTCCCTCCATTCTTAGTG No data
Right 951752163 3:26048466-26048488 GAAGCATCCTCTAATTGGCCTGG No data
951752155_951752165 7 Left 951752155 3:26048442-26048464 CCCCCTTCCCTCCATTCTTAGTG No data
Right 951752165 3:26048472-26048494 TCCTCTAATTGGCCTGGCTTGGG No data
951752155_951752162 -4 Left 951752155 3:26048442-26048464 CCCCCTTCCCTCCATTCTTAGTG No data
Right 951752162 3:26048461-26048483 AGTGTGAAGCATCCTCTAATTGG No data
951752155_951752164 6 Left 951752155 3:26048442-26048464 CCCCCTTCCCTCCATTCTTAGTG No data
Right 951752164 3:26048471-26048493 ATCCTCTAATTGGCCTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951752155 Original CRISPR CACTAAGAATGGAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr