ID: 951753827

View in Genome Browser
Species Human (GRCh38)
Location 3:26067133-26067155
Sequence CTGGCAGCCTAGATTTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951753822_951753827 10 Left 951753822 3:26067100-26067122 CCTTCAAGCACACTTTCCACTTA No data
Right 951753827 3:26067133-26067155 CTGGCAGCCTAGATTTATCAAGG No data
951753821_951753827 11 Left 951753821 3:26067099-26067121 CCCTTCAAGCACACTTTCCACTT No data
Right 951753827 3:26067133-26067155 CTGGCAGCCTAGATTTATCAAGG No data
951753825_951753827 -6 Left 951753825 3:26067116-26067138 CCACTTACAGAGGTGACCTGGCA No data
Right 951753827 3:26067133-26067155 CTGGCAGCCTAGATTTATCAAGG No data
951753820_951753827 22 Left 951753820 3:26067088-26067110 CCATTCTGAAACCCTTCAAGCAC No data
Right 951753827 3:26067133-26067155 CTGGCAGCCTAGATTTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951753827 Original CRISPR CTGGCAGCCTAGATTTATCA AGG Intergenic
No off target data available for this crispr