ID: 951754197

View in Genome Browser
Species Human (GRCh38)
Location 3:26071720-26071742
Sequence GATCTGGGAGAACCAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951754197_951754202 16 Left 951754197 3:26071720-26071742 CCCACTTCTGGTTCTCCCAGATC No data
Right 951754202 3:26071759-26071781 CCCAGTGTTAGAAATTCTCTTGG No data
951754197_951754204 17 Left 951754197 3:26071720-26071742 CCCACTTCTGGTTCTCCCAGATC No data
Right 951754204 3:26071760-26071782 CCAGTGTTAGAAATTCTCTTGGG No data
951754197_951754205 18 Left 951754197 3:26071720-26071742 CCCACTTCTGGTTCTCCCAGATC No data
Right 951754205 3:26071761-26071783 CAGTGTTAGAAATTCTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951754197 Original CRISPR GATCTGGGAGAACCAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr