ID: 951754984

View in Genome Browser
Species Human (GRCh38)
Location 3:26081063-26081085
Sequence CCACATTGTAACCCCCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951754984_951754992 11 Left 951754984 3:26081063-26081085 CCTCTAAGGGGGTTACAATGTGG No data
Right 951754992 3:26081097-26081119 ATGGCTGGCCATCTCTCTAGGGG No data
951754984_951754995 27 Left 951754984 3:26081063-26081085 CCTCTAAGGGGGTTACAATGTGG No data
Right 951754995 3:26081113-26081135 CTAGGGGCACACTGTATGGCTGG No data
951754984_951754990 9 Left 951754984 3:26081063-26081085 CCTCTAAGGGGGTTACAATGTGG No data
Right 951754990 3:26081095-26081117 GCATGGCTGGCCATCTCTCTAGG No data
951754984_951754994 23 Left 951754984 3:26081063-26081085 CCTCTAAGGGGGTTACAATGTGG No data
Right 951754994 3:26081109-26081131 CTCTCTAGGGGCACACTGTATGG No data
951754984_951754989 -4 Left 951754984 3:26081063-26081085 CCTCTAAGGGGGTTACAATGTGG No data
Right 951754989 3:26081082-26081104 GTGGCTGACATGGGCATGGCTGG No data
951754984_951754988 -8 Left 951754984 3:26081063-26081085 CCTCTAAGGGGGTTACAATGTGG No data
Right 951754988 3:26081078-26081100 CAATGTGGCTGACATGGGCATGG No data
951754984_951754991 10 Left 951754984 3:26081063-26081085 CCTCTAAGGGGGTTACAATGTGG No data
Right 951754991 3:26081096-26081118 CATGGCTGGCCATCTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951754984 Original CRISPR CCACATTGTAACCCCCTTAG AGG (reversed) Intergenic
No off target data available for this crispr