ID: 951758486

View in Genome Browser
Species Human (GRCh38)
Location 3:26118320-26118342
Sequence AGCTGTGCTCTGCAATTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951758486_951758493 10 Left 951758486 3:26118320-26118342 CCCCCCAATTGCAGAGCACAGCT No data
Right 951758493 3:26118353-26118375 GGAAATGCAAAGGAGCTGCGTGG No data
951758486_951758492 0 Left 951758486 3:26118320-26118342 CCCCCCAATTGCAGAGCACAGCT No data
Right 951758492 3:26118343-26118365 GCAAACTTGAGGAAATGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951758486 Original CRISPR AGCTGTGCTCTGCAATTGGG GGG (reversed) Intergenic
No off target data available for this crispr