ID: 951763638

View in Genome Browser
Species Human (GRCh38)
Location 3:26172425-26172447
Sequence CTGTATAAGCAGCATGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951763635_951763638 14 Left 951763635 3:26172388-26172410 CCTCTTTCTTTTGTAAATTTCTC No data
Right 951763638 3:26172425-26172447 CTGTATAAGCAGCATGAAAATGG No data
951763634_951763638 23 Left 951763634 3:26172379-26172401 CCAATTAAACCTCTTTCTTTTGT 0: 558
1: 591
2: 826
3: 3182
4: 6148
Right 951763638 3:26172425-26172447 CTGTATAAGCAGCATGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951763638 Original CRISPR CTGTATAAGCAGCATGAAAA TGG Intergenic
No off target data available for this crispr