ID: 951769120

View in Genome Browser
Species Human (GRCh38)
Location 3:26235357-26235379
Sequence TCTCATTCATTGTCTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951769120_951769124 -4 Left 951769120 3:26235357-26235379 CCCTGCAGAGACAATGAATGAGA No data
Right 951769124 3:26235376-26235398 GAGACTCGGGCCTCAGAGAAAGG No data
951769120_951769126 9 Left 951769120 3:26235357-26235379 CCCTGCAGAGACAATGAATGAGA No data
Right 951769126 3:26235389-26235411 CAGAGAAAGGACAGTGCCCCAGG No data
951769120_951769130 30 Left 951769120 3:26235357-26235379 CCCTGCAGAGACAATGAATGAGA No data
Right 951769130 3:26235410-26235432 GGTTGTTGATATCATATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951769120 Original CRISPR TCTCATTCATTGTCTCTGCA GGG (reversed) Intergenic
No off target data available for this crispr