ID: 951770145

View in Genome Browser
Species Human (GRCh38)
Location 3:26246151-26246173
Sequence CAATAGACGATATGGGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951770142_951770145 16 Left 951770142 3:26246112-26246134 CCACTGGAGCAATTTGAATATAG No data
Right 951770145 3:26246151-26246173 CAATAGACGATATGGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951770145 Original CRISPR CAATAGACGATATGGGCATT TGG Intergenic
No off target data available for this crispr