ID: 951778168

View in Genome Browser
Species Human (GRCh38)
Location 3:26333581-26333603
Sequence CAAGGTACTCAGAGAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951778168_951778172 12 Left 951778168 3:26333581-26333603 CCAGCATTTCTCTGAGTACCTTG No data
Right 951778172 3:26333616-26333638 TTATATTTTTTAGAAAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951778168 Original CRISPR CAAGGTACTCAGAGAAATGC TGG (reversed) Intergenic
No off target data available for this crispr