ID: 951779286

View in Genome Browser
Species Human (GRCh38)
Location 3:26345587-26345609
Sequence GGTCACTTCAGCAGTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951779285_951779286 -5 Left 951779285 3:26345569-26345591 CCTGGGTCAGTTTCTGCAGGTCA No data
Right 951779286 3:26345587-26345609 GGTCACTTCAGCAGTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951779286 Original CRISPR GGTCACTTCAGCAGTCCTAC AGG Intergenic
No off target data available for this crispr