ID: 951779475

View in Genome Browser
Species Human (GRCh38)
Location 3:26346769-26346791
Sequence TCCAGGAGGTGGTAGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 287}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951779466_951779475 4 Left 951779466 3:26346742-26346764 CCCAGCATGTGCACGCAGCTTCC 0: 1
1: 0
2: 0
3: 13
4: 95
Right 951779475 3:26346769-26346791 TCCAGGAGGTGGTAGGTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 287
951779464_951779475 22 Left 951779464 3:26346724-26346746 CCCATGGACAAGGCTGGTCCCAG 0: 1
1: 0
2: 6
3: 19
4: 174
Right 951779475 3:26346769-26346791 TCCAGGAGGTGGTAGGTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 287
951779462_951779475 29 Left 951779462 3:26346717-26346739 CCAGGAACCCATGGACAAGGCTG 0: 1
1: 0
2: 0
3: 16
4: 240
Right 951779475 3:26346769-26346791 TCCAGGAGGTGGTAGGTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 287
951779465_951779475 21 Left 951779465 3:26346725-26346747 CCATGGACAAGGCTGGTCCCAGC 0: 1
1: 3
2: 4
3: 31
4: 281
Right 951779475 3:26346769-26346791 TCCAGGAGGTGGTAGGTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 287
951779467_951779475 3 Left 951779467 3:26346743-26346765 CCAGCATGTGCACGCAGCTTCCA 0: 1
1: 0
2: 2
3: 6
4: 117
Right 951779475 3:26346769-26346791 TCCAGGAGGTGGTAGGTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951779475 Original CRISPR TCCAGGAGGTGGTAGGTCAG AGG Intergenic
900851050 1:5143351-5143373 AGCAGGAGGAGGGAGGTCAGGGG + Intergenic
901194744 1:7434043-7434065 TCCAGGAGGTGGAAGGGATGTGG - Intronic
902086898 1:13869633-13869655 TCCAGGAGGTGGGAGGAGACAGG - Intergenic
902810184 1:18883604-18883626 TACAGGAGGTGCTAGCTCAGGGG - Intronic
904091281 1:27946638-27946660 TGCAGGAGGTGGTGGAGCAGGGG + Intronic
905959082 1:42028416-42028438 TCAAGGAGGTGGAAGATCATGGG - Intronic
906851202 1:49251797-49251819 TCCAGGAGTTGGGAGCTGAGTGG + Intronic
907910804 1:58824571-58824593 GCCAGGGGGTGGTAGGGTAGGGG + Intergenic
908234085 1:62133820-62133842 CCCAGGAGGTGGAGGCTCAGTGG - Intronic
909360455 1:74753112-74753134 TCTAGCTGATGGTAGGTCAGTGG - Intronic
913529243 1:119721808-119721830 TCCAGAAGGTGGCAGGGAAGTGG - Intronic
915367967 1:155325896-155325918 TCCAGGAAGATGCAGGTCAGAGG + Exonic
915902413 1:159856146-159856168 ACCAGGAGGTGCCAGGTCAGGGG + Intronic
916040836 1:160960089-160960111 TCCAGGAGGAGGTGGGTGGGTGG - Intergenic
919724682 1:200873947-200873969 TCCAGCAGGAGGTAGATGAGCGG - Exonic
919773289 1:201176740-201176762 CCCAGGAGGTGAGAGGCCAGAGG - Intergenic
921222661 1:212984342-212984364 TCGAGGAGGTGGCAGGCCTGTGG + Intronic
923460510 1:234205903-234205925 TGCAGGGGGTGGTGGGTGAGGGG + Intronic
1067433791 10:46263662-46263684 TCCAGGAACAGGGAGGTCAGAGG - Intergenic
1067439891 10:46302646-46302668 TCCAGGAATAGGGAGGTCAGAGG + Intronic
1070174188 10:73956490-73956512 TGGAGGAGATGGTAGGTAAGGGG - Intergenic
1072051488 10:91708278-91708300 TCCAGGAGGGATTTGGTCAGGGG + Intergenic
1072525470 10:96267336-96267358 TGCAGGGTGTGGTAGGTGAGTGG + Intronic
1072826162 10:98608890-98608912 ACCTGGAGGTGGTAGGGCGGGGG - Intronic
1074100129 10:110348276-110348298 ACCATGAGGGGGTTGGTCAGGGG + Intergenic
1074364047 10:112843997-112844019 TTCAGGAGGAGGAAGGTTAGAGG + Intergenic
1074686351 10:115965574-115965596 GCCAGGAAGTGGTAGAACAGGGG - Intergenic
1075068444 10:119305155-119305177 CCAGGGAGGTGGAAGGTCAGAGG - Intronic
1075077972 10:119363982-119364004 TCCAGGAGGAGGTAGTGAAGAGG - Intronic
1075378251 10:121997051-121997073 GCCTGGAGGTGGGAGTTCAGGGG + Intronic
1075557217 10:123442341-123442363 TCCCGGAGCTAGTATGTCAGTGG + Intergenic
1075589807 10:123683408-123683430 CACAGGAGGTGCTGGGTCAGGGG + Intronic
1076496234 10:130899485-130899507 TCTTGGAGGTGGCAGGGCAGTGG + Intergenic
1076877778 10:133225019-133225041 ACCAGGAGGTGGAGGCTCAGGGG + Exonic
1077366782 11:2164446-2164468 TCCAGGAGAGGGGAGGCCAGGGG + Intronic
1077385624 11:2268307-2268329 TCCAGGAGGTGGTGGGCTGGTGG - Intergenic
1078011110 11:7573854-7573876 GCCTGTAGGTGATAGGTCAGTGG + Intronic
1078716245 11:13841584-13841606 TAGAGGAGGAGGCAGGTCAGTGG + Intergenic
1080690612 11:34554745-34554767 CCCAGAAGGTCGGAGGTCAGTGG - Intergenic
1083229657 11:61308244-61308266 TGCAAGGGGTGGTAGGTCATAGG - Intronic
1083780751 11:64916183-64916205 GCCAAGAGGTGTAAGGTCAGAGG - Intronic
1083947322 11:65931433-65931455 TCCAGGAAGTGGGAGGGGAGGGG - Intergenic
1085600870 11:77854971-77854993 TCCATGAGGTGTTAAGCCAGTGG - Intronic
1088528801 11:110785981-110786003 TCCTGGGGTTGGGAGGTCAGTGG - Intergenic
1089555038 11:119311544-119311566 TCCAGGAGATGGTGGGCCGGGGG + Exonic
1090211114 11:124921544-124921566 TCCAGGAGGTGGGCGTGCAGAGG - Intronic
1097332181 12:58343358-58343380 GCCAGGGGTTGGTAGGTGAGGGG - Intergenic
1100225922 12:92555490-92555512 TCCAGGAGGTGATATTTGAGTGG - Intergenic
1100655142 12:96635989-96636011 TCCAGGAGGTGGGAGGGGTGGGG + Intronic
1100668644 12:96785246-96785268 TCCAGTAGCCGGTATGTCAGAGG + Intronic
1104831239 12:131753270-131753292 CCCAGGAGGTGGTGGGGCGGTGG - Exonic
1104833893 12:131774175-131774197 GGCAGGACGTGGTAGGGCAGTGG + Intronic
1105323106 13:19346124-19346146 TCCAAGAGGTGGTGGAGCAGGGG + Intergenic
1105874283 13:24539743-24539765 TCCAAGAGGTGGTGGAACAGGGG - Intergenic
1111500782 13:89117924-89117946 TCCTTGAGGTTGTAGGACAGAGG - Intergenic
1112795511 13:103052258-103052280 CCCAAGAGGTGATAGTTCAGTGG + Intronic
1113343834 13:109454065-109454087 TCTTGGAGGTGTTAGGGCAGAGG + Intergenic
1114063246 14:19038473-19038495 TCCAGGGGGCGGTGGGTCAGAGG + Intergenic
1114099009 14:19361522-19361544 TCCAGGGGGCGGTGGGTCAGAGG - Intergenic
1115750057 14:36480164-36480186 TAGAGATGGTGGTAGGTCAGTGG - Intronic
1117776580 14:59189579-59189601 GCCAGGAGGTGGTAGCGCGGGGG + Intronic
1119682745 14:76605032-76605054 GCCTGGAGGTGGAAGGTAAGTGG + Intergenic
1121108525 14:91296409-91296431 TCCAGGAGGTTTCAGGTCAGGGG - Intronic
1121273265 14:92651792-92651814 TCCAAGAGGTGGCTGGTCGGTGG - Exonic
1121479664 14:94254798-94254820 TCCAGGAGGAGGCATTTCAGAGG - Intronic
1122343398 14:101043446-101043468 ACCAGGGAGTGGCAGGTCAGGGG - Intergenic
1123065439 14:105616726-105616748 TCTGGGAGGTGGTCGGGCAGAGG + Intergenic
1123069642 14:105636192-105636214 TCTGGGAGGTGGTCGGGCAGAGG + Intergenic
1123088735 14:105731975-105731997 TCTGGGAGGTGGTCGGGCAGAGG + Intergenic
1124097732 15:26664786-26664808 CCCAGGAGGTGGCAGTGCAGAGG - Intronic
1126703464 15:51386951-51386973 TACAGGAGGAGGTGGGGCAGTGG + Intronic
1127954702 15:63843294-63843316 GCCAGGAGGTGGTGTGTAAGGGG - Intergenic
1128128491 15:65210336-65210358 TCATGGAGGTGGTATGTCCGAGG - Intronic
1129226707 15:74174470-74174492 GCCAGGATGTGGGAGGGCAGGGG + Intronic
1129455515 15:75674473-75674495 CCCAGGAGGTGGAAGTTCAGAGG + Exonic
1129699647 15:77760256-77760278 TCAAGGAGGTGGGAGACCAGGGG + Intronic
1131511701 15:93052650-93052672 TCCTGCAGGTGGTAGGAAAGGGG + Intronic
1132209075 15:100007239-100007261 TCCAGGAGGTGGAGGGACTGTGG + Intronic
1132359615 15:101201550-101201572 TCCAGCAGGCGGTTGGGCAGTGG + Intronic
1132671853 16:1105341-1105363 TCCAGCAGGTGCTAGGCCACTGG + Intergenic
1133436734 16:5786305-5786327 TCCTGGACTTGGGAGGTCAGAGG - Intergenic
1136053597 16:27671538-27671560 TCCTGGAAGGGCTAGGTCAGAGG + Intronic
1138173537 16:54875484-54875506 TGCAGGAGATGGAAGGACAGAGG - Intergenic
1139265292 16:65632659-65632681 TCCAGGAGGAGGGTGATCAGGGG - Intergenic
1140877536 16:79166706-79166728 TGCTGGAAGTGGTAGTTCAGCGG - Intronic
1141252428 16:82370489-82370511 TCCAGGAGTTGGAAGGTGTGGGG + Intergenic
1141820559 16:86442565-86442587 TCCAGGAGGAGTCAGGTCACAGG + Intergenic
1142782580 17:2192611-2192633 TCCAGGTGGTGGTAGTTTGGAGG - Intronic
1144037094 17:11376853-11376875 TCCCGGATTTAGTAGGTCAGAGG - Intronic
1145125613 17:20297746-20297768 TGTAGGAGGTTCTAGGTCAGGGG - Intronic
1145812132 17:27770866-27770888 TCTAGGGGGTGGTAGGGCACGGG - Intronic
1146702379 17:34972457-34972479 TCAAGGAGATTCTAGGTCAGTGG + Intronic
1147120386 17:38332057-38332079 TCCAGAAAGTGGAGGGTCAGGGG + Intronic
1147163624 17:38581888-38581910 TGGAGGAGGAGGAAGGTCAGGGG - Intronic
1147369959 17:39985555-39985577 TGCAGGTGCTGGAAGGTCAGTGG - Intronic
1148282775 17:46361788-46361810 TCCAGGAGGCGGTGGGTGATTGG - Intronic
1148304993 17:46579713-46579735 TCCAGGAGGCGGTGGGTGATTGG - Intronic
1148582305 17:48752482-48752504 GCCAGGAGTTGGAAGTTCAGGGG - Intergenic
1148690996 17:49526887-49526909 TCAAGGAGGTTGCAGTTCAGGGG - Intergenic
1148978729 17:51552263-51552285 TCATGTAGGTGGTAGGTAAGTGG - Intergenic
1149491038 17:57085388-57085410 CCGAGGAGCTGGTAGGTCGGGGG + Intronic
1151309086 17:73282510-73282532 GGAAGGAGGTGGTAGGGCAGGGG + Intergenic
1152798190 17:82318080-82318102 TCCTGGAGGCGGGAGGTCTGAGG + Intergenic
1153575091 18:6512047-6512069 TGCTGGAGGCTGTAGGTCAGAGG - Intronic
1154328241 18:13407715-13407737 GCCAGGAGCTGATAGGGCAGTGG + Intronic
1155161487 18:23199649-23199671 GACAGAAGGTGGTAGGTAAGAGG + Intronic
1157366279 18:47067502-47067524 TCCTGGGGAGGGTAGGTCAGGGG - Intronic
1159573587 18:70147961-70147983 TCCAGGAAGAAGTAGGGCAGAGG - Intronic
1159929008 18:74293292-74293314 TCCTGGAGCTGGTTGGTCTGAGG - Intergenic
1160103334 18:75945002-75945024 CCTAGGAGGTAGGAGGTCAGGGG + Intergenic
1160487601 18:79308651-79308673 CCCAGTAGGTAGAAGGTCAGGGG + Intronic
1160487611 18:79308687-79308709 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487621 18:79308723-79308745 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487630 18:79308759-79308781 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487637 18:79308795-79308817 CCCAGCAGGTAGAAGGTCAGAGG + Intronic
1160487646 18:79308831-79308853 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487655 18:79308867-79308889 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487664 18:79308903-79308925 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487674 18:79308939-79308961 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487683 18:79308975-79308997 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487693 18:79309011-79309033 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487702 18:79309047-79309069 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487712 18:79309083-79309105 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487722 18:79309119-79309141 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487731 18:79309155-79309177 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487738 18:79309191-79309213 CCCAGCAGGTAGAAGGTCAGAGG + Intronic
1160487747 18:79309227-79309249 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487757 18:79309263-79309285 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487766 18:79309299-79309321 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487775 18:79309335-79309357 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487784 18:79309371-79309393 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487794 18:79309407-79309429 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487804 18:79309443-79309465 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487813 18:79309479-79309501 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487821 18:79309515-79309537 TCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487831 18:79309551-79309573 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487840 18:79309587-79309609 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487849 18:79309623-79309645 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487858 18:79309659-79309681 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160854769 19:1211773-1211795 GCCAGGAGGTGGGAGGTGGGCGG + Intronic
1161984225 19:7645016-7645038 ACCTGGAGGGGGTAGATCAGGGG - Intronic
1163810862 19:19430590-19430612 TACAGATGGTGATAGGTCAGTGG + Intronic
1165342564 19:35223473-35223495 ACCAGGAGGTGGGAAGTCACTGG + Intergenic
1165655229 19:37526832-37526854 TCCTGGAGGTGGTAGGCCAGTGG + Intronic
1165856048 19:38879706-38879728 TCAGGGAGGGGGTGGGTCAGGGG + Intronic
1165923083 19:39310816-39310838 TCCTGGAGGTGGGATGACAGAGG - Intronic
1166065495 19:40356080-40356102 TGGAGGAGGTGGTATGTGAGCGG + Intronic
1166976620 19:46608658-46608680 TCCTGGAAGTGGTAGCTCCGTGG - Intronic
1168075129 19:53977051-53977073 TCCTGGAGGGGGTAGGGCATGGG - Intronic
1168666602 19:58209531-58209553 TCCATGAGGTGGGAGGAGAGAGG + Intronic
924976214 2:178035-178057 TGCAGAAGGGAGTAGGTCAGGGG + Intergenic
925260792 2:2526753-2526775 TGGAGGAGCTGGGAGGTCAGGGG - Intergenic
925364624 2:3303422-3303444 TCCAGGTGGTGGTCGGTCCCTGG - Intronic
925768207 2:7258408-7258430 TCCCCAAGGTGGTAGATCAGAGG + Intergenic
925865407 2:8222311-8222333 TCCTGGAGGTTGTAGAACAGGGG - Intergenic
926419840 2:12685749-12685771 TGCAGGAGGTGGCATGTGAGGGG - Intergenic
927505021 2:23607246-23607268 ACCAGGAGGTGGTGACTCAGAGG + Intronic
928359419 2:30650748-30650770 GACAGGTGGTGGTAGGTCAAGGG + Intergenic
928808292 2:35189324-35189346 TTCAGAAGGTGGAAGGTGAGAGG - Intergenic
929016460 2:37502062-37502084 TCAAGGATGTCTTAGGTCAGTGG - Intergenic
929172537 2:38946159-38946181 TCCAGCAGGCGGGAGGTCATAGG + Intronic
930826281 2:55700027-55700049 GCCTGGAGGTGGGAAGTCAGGGG + Intergenic
932415252 2:71569748-71569770 TCCAGGAGGTGGTAGATGGATGG + Intronic
933141124 2:78793842-78793864 TCTAGGAGGTGGCAAGTGAGAGG + Intergenic
933193266 2:79360988-79361010 TCAAGAAGGTGGGAGGTCAAGGG + Intronic
937680027 2:124633817-124633839 TCCAGGTGGTGTTAAGTCTGAGG - Intronic
938297189 2:130185655-130185677 TCCAGGTGCTGGTAGGCCGGGGG + Intronic
940140621 2:150487223-150487245 TCCACGAGGGGGTCGGCCAGTGG - Intronic
942516432 2:176758134-176758156 TCCAGGAGCTTCTAGCTCAGGGG - Intergenic
945041569 2:205747118-205747140 TCCAGGAGCTTGTAAGCCAGTGG + Intronic
945949248 2:216023222-216023244 GCCAGGAGGTGGCAGCACAGAGG - Intronic
947373968 2:229476321-229476343 TCCAGGAGGGTGTTGGTAAGAGG - Intronic
948131999 2:235607749-235607771 TCCTGGAGGTGGAAGGGCAGCGG + Intronic
948182042 2:235989718-235989740 CCCTGGAGGAGGTGGGTCAGTGG + Intronic
948648324 2:239423026-239423048 ACCAGGAAGTGGCAGGTCAGGGG + Intergenic
1169604556 20:7302174-7302196 TTCAGGTGGTGGAAGGTCTGAGG + Intergenic
1171453483 20:25252713-25252735 TCCTGGAGGTGCTGGGACAGTGG - Intronic
1173020706 20:39265562-39265584 TCCAGGAGGTGTCAGGGAAGAGG + Intergenic
1174110075 20:48192972-48192994 TCCAGGAGGAGGAAGGACTGTGG - Intergenic
1174238523 20:49114346-49114368 TGCAGGAGGTGGTGGGGCCGTGG + Exonic
1175477744 20:59288835-59288857 CCCAGGAGGTGGAAGGTCAATGG - Intergenic
1175877630 20:62238033-62238055 TTCAGGATTTGGTAGGACAGTGG + Intronic
1175969307 20:62675812-62675834 CCCAGGACGTGGGAGGACAGGGG - Intronic
1176159273 20:63640388-63640410 TCCAGGTGTTGGAAGGGCAGCGG - Exonic
1178427917 21:32493611-32493633 GACAAGAGGTGCTAGGTCAGAGG - Intronic
1179198049 21:39183840-39183862 GCCAGGAGGTGGGAGGACTGCGG + Exonic
1179502799 21:41820599-41820621 TCCTGGAGGCGGGAGCTCAGGGG - Intronic
1180481738 22:15761102-15761124 TCCAGGGGGCGGTGGGTCAGAGG + Intergenic
1181778777 22:25178336-25178358 TCCAGGTGTTGGAAGGGCAGTGG - Intronic
1181932739 22:26415756-26415778 TGCAGAAGGTGGGTGGTCAGGGG - Intergenic
1182667888 22:31972475-31972497 TCCAGGAGGTGCCAGGGCAGTGG + Intergenic
1183750219 22:39715867-39715889 GCCAGGAAGTGGCAGGTCTGGGG - Intergenic
1184631666 22:45785830-45785852 TCCAGGAGGACGTGGCTCAGAGG - Intronic
1184965022 22:47965441-47965463 TCTAGGAGGTGGTAGGGGTGGGG - Intergenic
1185395045 22:50582543-50582565 CCCGTGAGGTGGGAGGTCAGGGG - Exonic
949396652 3:3621763-3621785 TCCAGTAGGTGGTAGTGGAGGGG - Intergenic
950125290 3:10506627-10506649 TCCTGGAGGGGGCAGGGCAGTGG - Intronic
951779475 3:26346769-26346791 TCCAGGAGGTGGTAGGTCAGAGG + Intergenic
953908609 3:46881258-46881280 ACCGGGAGGTGGTAGGTTTGGGG + Intronic
960775768 3:121251140-121251162 TGCAGGATGTGGTAGATGAGTGG - Intronic
962271136 3:133978833-133978855 CAGAGGAGGTGGGAGGTCAGAGG - Intronic
962359782 3:134728602-134728624 TCAAGGAGCTGGCAGGGCAGTGG + Intronic
962804149 3:138915356-138915378 TCCAGGAGCTGGGAGTGCAGCGG + Intergenic
963841230 3:150108694-150108716 TACAGGAGGTTGTGGGACAGGGG - Intergenic
966305646 3:178531053-178531075 CCCAGGAGATGGGAGGTCAGGGG - Intronic
967501585 3:190204006-190204028 TCCAGGAGGTGTTGGGCCCGTGG + Intergenic
967708481 3:192679488-192679510 CTCAGGAGGTGGGAGGTCAGAGG + Intronic
967773888 3:193364263-193364285 TCCAGGAGGTGTTTGGTTACCGG - Exonic
968086553 3:195876596-195876618 CTCAGGAGGTGGGAGGTGAGGGG - Intronic
968390869 4:192109-192131 TCCAGAAGGTTGGAAGTCAGTGG + Intergenic
969410144 4:7022641-7022663 GCCAGGAGGTGGAAGCTCATGGG + Intronic
969488159 4:7483743-7483765 TCCAGGGGGTGGGGGGCCAGGGG + Intronic
971351515 4:25860347-25860369 TGGAGGAAGTGGTTGGTCAGGGG - Intronic
971950550 4:33340147-33340169 TACAGGAGGTTGTAGGACTGAGG - Intergenic
973001452 4:44956560-44956582 TTCATATGGTGGTAGGTCAGTGG + Intergenic
973690753 4:53428106-53428128 TGGAGGAGGTGGAAGGTGAGTGG - Exonic
978532898 4:109731984-109732006 TTCAGGTGGTGGTATCTCAGAGG - Intergenic
980989696 4:139728724-139728746 ACAAGGAGGTGAGAGGTCAGGGG - Intronic
981298752 4:143163307-143163329 TACAGGTTCTGGTAGGTCAGAGG - Intergenic
981577876 4:146223699-146223721 TCCCGGAGGTGGGAGATCACAGG - Intergenic
982139227 4:152301832-152301854 TGAATGAGGTGGTAGGGCAGGGG + Intergenic
983209904 4:164947899-164947921 TCCAGGGGGAGGCAGGTCACAGG - Intergenic
983990836 4:174117754-174117776 TGCTGGAGGTGGTAGTTCTGGGG + Intergenic
985476082 5:80052-80074 TCCAGGCTGTGGTGGGTCATGGG - Intergenic
985748933 5:1663549-1663571 GGCAGGAGCTGGGAGGTCAGGGG + Intergenic
985861670 5:2476411-2476433 ACAAGAAGGTGGAAGGTCAGGGG + Intergenic
988346762 5:30047070-30047092 TCCTGGACGTGGTAGGACAGAGG + Intergenic
988395659 5:30695112-30695134 TACAGCAGGTGGTAGAACAGTGG - Intergenic
991500066 5:67268083-67268105 AGCAGGAGGCTGTAGGTCAGTGG + Intergenic
992154290 5:73939607-73939629 TCCAGTAGGAGGTGGGTCAATGG - Intronic
992302298 5:75395467-75395489 TCCAGGAAGTCAGAGGTCAGAGG + Intronic
992645137 5:78804760-78804782 TCCGGGAGCTGGGAGGTCAGAGG - Intronic
994338069 5:98592728-98592750 TCTAGTAGGTGGTTGGTGAGAGG - Intergenic
997285696 5:132676604-132676626 TCCAGGAGGATGAAGTTCAGGGG - Intronic
997295141 5:132764296-132764318 TCCTGGAGGTCATAGGTCTGGGG + Exonic
997422631 5:133781182-133781204 TGCAGGAGGTGGGAGGTAAAAGG - Intergenic
997726999 5:136129955-136129977 TCAAGGAGGGAGTAGGTCATGGG + Intergenic
997836402 5:137196758-137196780 TCCAGGAGCTTATAGTTCAGTGG - Intronic
998527292 5:142854408-142854430 TCCAGTAGGTTGTAGGTTTGGGG + Intronic
1001745922 5:174092221-174092243 GCCAGGAGATGGGAAGTCAGGGG + Intronic
1002711739 5:181198995-181199017 ATCAGGAGGTGAGAGGTCAGGGG + Intronic
1003664950 6:8102248-8102270 TCCAGGAGGTAGGATGGCAGGGG + Intronic
1006518384 6:34557025-34557047 TCAAGGAGGTGGAGGGTCTGGGG - Intergenic
1006677457 6:35774629-35774651 TCCAGCAGGTGGTTTGTGAGTGG + Intergenic
1007167970 6:39841632-39841654 TCCAGGATGAGGTGGGTAAGTGG + Intronic
1008147066 6:47904534-47904556 TCCAGGAGATTCTAAGTCAGAGG - Intronic
1014725070 6:124962981-124963003 TCCTGGACGTGCTGGGTCAGCGG + Exonic
1014763189 6:125380954-125380976 TCCAGGAGGTGGAGAGTTAGAGG + Intergenic
1018134486 6:160766860-160766882 TCCAGCAGGTGTTAGAACAGAGG + Intergenic
1018150371 6:160931522-160931544 TCCAGCAGGTGTTAGAACAGAGG - Intergenic
1018629442 6:165809561-165809583 TCCAGGAGTTGGCAGGCTAGAGG - Intronic
1018740078 6:166721804-166721826 CCCAGGAGGTGCCAGCTCAGAGG + Intronic
1019308792 7:348877-348899 TCCAGGCGGGGCAAGGTCAGTGG + Intergenic
1019604612 7:1902164-1902186 TCCAGGAGGAGGCAGGTGTGGGG - Intronic
1019629014 7:2036600-2036622 TCCAGGCAGTGGTAAATCAGAGG + Intronic
1019801174 7:3089482-3089504 GCCAGAAGGTGGGAGGGCAGGGG - Intergenic
1019942940 7:4305573-4305595 CCCAGGAGTTGGCTGGTCAGTGG + Intergenic
1024109963 7:46134691-46134713 GGCAGGAGGAGGTAGGCCAGGGG + Intergenic
1024526362 7:50353357-50353379 TGCAGGAGGTGTTAGGGCAGGGG - Intronic
1025007066 7:55363316-55363338 CCCCGGAGGTGGGAGGTCACTGG - Intergenic
1029445934 7:100612814-100612836 ACCAGGAGCTGGTGGGTCCGGGG + Exonic
1029530547 7:101122403-101122425 GCCAGAAGGCGGGAGGTCAGGGG + Intergenic
1030090880 7:105857458-105857480 TCCAGGAGGTGGAAGGCCCTGGG - Intronic
1032402489 7:131633508-131633530 CCCATGAGTTGCTAGGTCAGAGG - Intergenic
1033586791 7:142780221-142780243 CCCAGCAGATGGTAGGTCTGGGG + Intergenic
1034875503 7:154721330-154721352 CCCAGCAGCTGGTGGGTCAGGGG - Intronic
1035470898 7:159107928-159107950 TCCAGCAGGTGGGAGGTTTGGGG - Intronic
1037773025 8:21814022-21814044 GGCAGGGGGTGGTGGGTCAGAGG - Intergenic
1037880112 8:22569184-22569206 TCCAGCACCTGGTAGGTCGGGGG - Exonic
1037885781 8:22595494-22595516 TCCTGGAGGTAGAAGGCCAGTGG + Intronic
1037943738 8:22973790-22973812 TGCAGGAGGGGGTAGCACAGAGG + Intronic
1037952362 8:23027686-23027708 TCCAGGAGCTGGGGGCTCAGGGG - Intronic
1039659875 8:39449958-39449980 TCTAGGAGGGGGTAAGTGAGAGG - Intergenic
1045017150 8:98009887-98009909 TCCAGGAGCTTGCAGGCCAGTGG - Intronic
1045017155 8:98009903-98009925 TCCTGGAGGTTGGAGGTCAGAGG + Intronic
1045791360 8:105988222-105988244 TCCAGTAGGTGGTACCCCAGTGG - Intergenic
1045886303 8:107101538-107101560 TCTAGGATGTAGTAGGTCACAGG + Intergenic
1045960784 8:107965509-107965531 TCCTGGAGGTGCTAAGCCAGAGG + Intronic
1046648595 8:116812431-116812453 TACAGGAGGTGGAAGCTAAGGGG + Intronic
1048837567 8:138536013-138536035 TCCAGGAGGTGGTGTGCAAGAGG + Intergenic
1049207935 8:141372033-141372055 CCCAGGAGGTGCTGGGTGAGTGG + Intergenic
1049371418 8:142269682-142269704 TCCTGGAGGTGGTGGGACTGAGG + Intronic
1049472791 8:142783771-142783793 TCCAGGAGGGGGTTGCACAGTGG + Intergenic
1049654776 8:143792700-143792722 TGCAGGAGGAGGAAGGTGAGGGG - Exonic
1051345230 9:16145296-16145318 TCCAGGAGGTGGAAGCAGAGAGG - Intergenic
1052665295 9:31487615-31487637 TCTAGGAGTTGGTATCTCAGAGG - Intergenic
1054951682 9:70858918-70858940 TCCAGGATGGGGAAGGTCAGGGG + Intronic
1055517998 9:77052561-77052583 TCCTGGAGGTGGTAGATGATTGG - Intergenic
1057696298 9:97325080-97325102 TCCAGGAGGTGGTACAACTGTGG + Exonic
1057705146 9:97390529-97390551 TCCAGGAGGGGAGATGTCAGTGG - Intergenic
1057798751 9:98176486-98176508 TCCAGGAACAGGTAGGGCAGTGG - Intronic
1058455059 9:105130993-105131015 TCCAGGAGAGGGAAGGTCAGGGG + Intergenic
1059347483 9:113639468-113639490 TCCTGGAGGTGTTAGTTCCGAGG + Intergenic
1060238603 9:121884445-121884467 GGCAGGACGGGGTAGGTCAGTGG - Intronic
1060344858 9:122807129-122807151 TCCAGGAGTTCCTAGGCCAGTGG - Intronic
1060716908 9:125940104-125940126 TCCAGGAGGTGGAAGTTGTGGGG + Intronic
1060985875 9:127818672-127818694 TCCAGGAGCTGGGAGGCCCGAGG + Intronic
1061766939 9:132887495-132887517 TCCAGGAGGTTGTTGGTGACTGG - Exonic
1061931093 9:133833615-133833637 TCCAGGAGGAGGGAGGTAGGAGG - Intronic
1062516466 9:136939445-136939467 ACCAGGAGTTGGCAGGGCAGAGG + Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1190595082 X:52044244-52044266 TCCAGGTGGTGGTGGGGCGGAGG - Intergenic
1190613742 X:52209829-52209851 TCCAGGTGGTGGTGGGGCGGAGG + Intergenic
1193238078 X:79132719-79132741 TCCAGGAGTGGGAAGGTGAGGGG + Intergenic
1198069568 X:133134738-133134760 TACAGTGGGTGGTAGGTCAGTGG + Intergenic
1198138548 X:133779799-133779821 ACCAGGATGTGGTAGGAGAGGGG - Intronic
1199724161 X:150565616-150565638 TCTAGGAGGTGAGAGGCCAGAGG + Intergenic
1199973322 X:152876523-152876545 TCCAGGAGTTGGAAGCTCTGAGG + Intergenic
1200032842 X:153310398-153310420 TCCTTGAGGTGGTAGGGCCGTGG + Intergenic
1200211635 X:154349223-154349245 TCCAGGAGGTGGCAGGGAGGTGG + Intronic