ID: 951780552

View in Genome Browser
Species Human (GRCh38)
Location 3:26358323-26358345
Sequence CTGTTTACACACATGATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951780550_951780552 -6 Left 951780550 3:26358306-26358328 CCATTGGAACCACTGATCTGTTT No data
Right 951780552 3:26358323-26358345 CTGTTTACACACATGATGCCAGG No data
951780549_951780552 7 Left 951780549 3:26358293-26358315 CCAGGATTTTAAACCATTGGAAC No data
Right 951780552 3:26358323-26358345 CTGTTTACACACATGATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951780552 Original CRISPR CTGTTTACACACATGATGCC AGG Intergenic
No off target data available for this crispr