ID: 951788542

View in Genome Browser
Species Human (GRCh38)
Location 3:26452615-26452637
Sequence TCATGGGTCTGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951788537_951788542 -8 Left 951788537 3:26452600-26452622 CCAAATACACTGGAATCATGGGT No data
Right 951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG No data
951788535_951788542 -7 Left 951788535 3:26452599-26452621 CCCAAATACACTGGAATCATGGG No data
Right 951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG No data
951788532_951788542 21 Left 951788532 3:26452571-26452593 CCAAAGAAAACAAGTACAGATAA No data
Right 951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951788542 Original CRISPR TCATGGGTCTGGAGGGAAGA GGG Intergenic
No off target data available for this crispr