ID: 951793713

View in Genome Browser
Species Human (GRCh38)
Location 3:26515481-26515503
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 3, 1: 1, 2: 12, 3: 82, 4: 761}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951793713_951793725 4 Left 951793713 3:26515481-26515503 CCCTCTCCCGTCTCCCTCTGTTG 0: 3
1: 1
2: 12
3: 82
4: 761
Right 951793725 3:26515508-26515530 GGCTGGACTGTACTGCTGGTGGG No data
951793713_951793722 0 Left 951793713 3:26515481-26515503 CCCTCTCCCGTCTCCCTCTGTTG 0: 3
1: 1
2: 12
3: 82
4: 761
Right 951793722 3:26515504-26515526 CCCAGGCTGGACTGTACTGCTGG No data
951793713_951793724 3 Left 951793713 3:26515481-26515503 CCCTCTCCCGTCTCCCTCTGTTG 0: 3
1: 1
2: 12
3: 82
4: 761
Right 951793724 3:26515507-26515529 AGGCTGGACTGTACTGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951793713 Original CRISPR CAACAGAGGGAGACGGGAGA GGG (reversed) Intergenic
900146319 1:1160401-1160423 CAAGGGAGGGAGACAGTAGAGGG + Intergenic
900298789 1:1966226-1966248 CAGGAGAGGGTGGCGGGAGATGG + Intronic
900381236 1:2385095-2385117 CAACAGGGGGAGCCGGGTGGTGG + Intronic
900690369 1:3977169-3977191 CAAGAGACGGTGGCGGGAGAGGG + Intergenic
900746151 1:4362060-4362082 CAGCTGGGGGAGAGGGGAGATGG + Intergenic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
900916664 1:5644338-5644360 CAGCAGAGGAAGCCGGGAAAGGG + Intergenic
901108485 1:6776377-6776399 CATCAGAGTGAGACTTGAGATGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901428331 1:9197691-9197713 GAGGAGAGGGAGACTGGAGAGGG - Intergenic
902018440 1:13327503-13327525 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018446 1:13327522-13327544 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018452 1:13327541-13327563 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018458 1:13327560-13327582 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018464 1:13327579-13327601 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018470 1:13327598-13327620 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018476 1:13327617-13327639 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018482 1:13327636-13327658 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902018488 1:13327655-13327677 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
902081881 1:13826855-13826877 CAACAGTCGGGGACGGGAAAAGG + Intergenic
902373967 1:16021620-16021642 GCACAGAGGGAGAGGGGAGGAGG - Intronic
902378890 1:16043455-16043477 GCACAGAGGGAGAGGGGAGGAGG - Intergenic
902534569 1:17112114-17112136 CAACAGAGGAAGTGGGGAGGAGG + Intronic
902720247 1:18299467-18299489 ATACAGAGGGAGAAGGGAGCTGG - Intronic
902939205 1:19787607-19787629 CATCAGATGGGGAAGGGAGATGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903147868 1:21387055-21387077 GGGGAGAGGGAGACGGGAGAGGG - Intergenic
903338989 1:22642673-22642695 GAGAAGAGGGAGAGGGGAGAAGG + Intergenic
903638148 1:24834799-24834821 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638154 1:24834818-24834840 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638160 1:24834837-24834859 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638166 1:24834856-24834878 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638170 1:24834869-24834891 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903638176 1:24834888-24834910 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638180 1:24834901-24834923 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903638188 1:24834926-24834948 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638194 1:24834945-24834967 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903638198 1:24834958-24834980 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903638204 1:24834977-24834999 AGGGAGAGGGAGACGGGAGAGGG + Intronic
903921802 1:26804853-26804875 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903921808 1:26804872-26804894 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903921814 1:26804891-26804913 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905615166 1:39391968-39391990 GAAGAGTGGGAGAAGGGAGAAGG + Intronic
906289288 1:44609620-44609642 CAACAGAGGGGGGCAGCAGAGGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906527882 1:46506976-46506998 CTACAGACGGAAAAGGGAGAGGG - Exonic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907181286 1:52572641-52572663 AGAGAGAGGGAGAAGGGAGAGGG - Intergenic
907241564 1:53083996-53084018 TGACAGAGGGAGCTGGGAGAAGG + Intronic
908046230 1:60172090-60172112 CAAGAGAGGGATGCGGGAGAGGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908680427 1:66654874-66654896 CAACAGAGACAGAGGGCAGATGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910597919 1:88999166-88999188 CAAAATTGGGAGAAGGGAGACGG - Intergenic
911378358 1:97079847-97079869 GAATAGAGGAAGACGGGGGAAGG - Intronic
911568535 1:99494305-99494327 CACCAGAGGGAGAAGGCACAAGG - Intergenic
911569616 1:99507593-99507615 CAACAGAGGGAGAGGGGGAGGGG - Intergenic
912303119 1:108536854-108536876 GAGAGGAGGGAGACGGGAGAGGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912883320 1:113441308-113441330 CAACAGGGTGAGAAGGCAGAAGG - Intronic
913260115 1:116990066-116990088 CAACAGAGGAAGAAGGGAACTGG + Exonic
913702217 1:121384449-121384471 GAACAGATGGAGAAGTGAGATGG + Intronic
914042775 1:144064918-144064940 GAACAGATGGAGAAGTGAGATGG + Intergenic
914135311 1:144895570-144895592 GAACAGATGGAGAAGTGAGATGG - Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915089895 1:153416920-153416942 CCACAGAGGGAGGAGGGATAAGG + Intronic
915388471 1:155518784-155518806 CAGGAGAGGTAGAGGGGAGACGG + Intronic
915538150 1:156550145-156550167 CCACAGAGGTTGAAGGGAGAGGG + Intronic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
916867788 1:168878961-168878983 GAAGAGAGGGAGATGGCAGATGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG + Intronic
917848617 1:179041679-179041701 AGGGAGAGGGAGACGGGAGACGG + Intronic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
918109436 1:181442568-181442590 CAACAGAGGAAGTGGGGAGGTGG - Intronic
918251036 1:182703566-182703588 GAACAGAGGTAGAAGGTAGAAGG - Intergenic
920073434 1:203320124-203320146 CGACAGTTGGAGAGGGGAGAAGG - Intergenic
920489639 1:206403164-206403186 GAACAGATGGAGAAGTGAGATGG + Intronic
920780906 1:208990187-208990209 AAACAGAGGGAGAGGGGAAAGGG + Intergenic
921750123 1:218782527-218782549 CAAGAGAGAGAGAGGGGAGCAGG - Intergenic
922137712 1:222847730-222847752 CAACCCAGGGGGAAGGGAGAAGG + Intergenic
922306685 1:224350652-224350674 GGAAAGTGGGAGACGGGAGAGGG + Intergenic
922306689 1:224350665-224350687 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922469790 1:225868952-225868974 CTACAGAGGGAGAAGGGGCAGGG + Intronic
922812733 1:228426836-228426858 CGCCAGAGAGAGAGGGGAGAGGG - Intergenic
923629996 1:235643343-235643365 CAACAGAGGGAGTCTTGAGCTGG - Intronic
923841037 1:237670326-237670348 AGGGAGAGGGAGACGGGAGAGGG + Intronic
924719983 1:246613696-246613718 CAGAAGAGGGAGACGGGAAGAGG - Intronic
924836373 1:247651817-247651839 CAACAGAGAGAGAGCGGGGAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063610459 10:7557596-7557618 CAAGAGAGGGAGAGGGGATGTGG + Intergenic
1063921503 10:10938089-10938111 CAAGAGAGATAGAGGGGAGATGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065840144 10:29695798-29695820 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840148 10:29695811-29695833 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840154 10:29695830-29695852 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840162 10:29695855-29695877 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840168 10:29695874-29695896 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840174 10:29695893-29695915 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840180 10:29695912-29695934 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1065840192 10:29695949-29695971 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1066085112 10:31968968-31968990 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085118 10:31968987-31969009 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085124 10:31969006-31969028 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085130 10:31969025-31969047 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085136 10:31969044-31969066 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085142 10:31969063-31969085 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085148 10:31969082-31969104 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066085154 10:31969101-31969123 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1066174889 10:32893284-32893306 CAACAGAGGGAGGCGGGAAGCGG + Intergenic
1066283781 10:33944040-33944062 GGAGAGAGGGAGAGGGGAGAAGG + Intergenic
1067099643 10:43325270-43325292 CAACAGAGGCAGACTGCACATGG + Intergenic
1068075690 10:52250150-52250172 CAACATAGTGATCCGGGAGATGG - Intronic
1068261985 10:54594767-54594789 CAACAGGGGGAGAAGGGATGGGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069010768 10:63369165-63369187 CAACAGAGTGAGACGAGAAGAGG - Intronic
1069606489 10:69742069-69742091 CAAGTGAGTGAGAAGGGAGAAGG - Intergenic
1069607699 10:69750106-69750128 CCACAGAGGGAGACGAGAGGAGG - Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1070629833 10:78076648-78076670 AGAGAGAGGGAGAGGGGAGAGGG + Intergenic
1071213333 10:83369750-83369772 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071213355 10:83369974-83369996 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071265068 10:83957714-83957736 CAAGAGAGGGAGCTGGGAGAAGG + Intergenic
1072180135 10:92974548-92974570 GGGGAGAGGGAGACGGGAGAGGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072999450 10:100276308-100276330 AGAGAGAGGGAGACGGGAGAGGG - Intronic
1072999458 10:100276340-100276362 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999462 10:100276353-100276375 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999466 10:100276366-100276388 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999470 10:100276379-100276401 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999476 10:100276398-100276420 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999482 10:100276417-100276439 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999488 10:100276436-100276458 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999494 10:100276455-100276477 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999500 10:100276474-100276496 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999508 10:100276499-100276521 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1073122887 10:101132891-101132913 CAGCAGAGGAAGGCGGGAGCGGG - Intronic
1073630514 10:105143797-105143819 CTACAGCGGGAGAAGGGAGTAGG - Intronic
1074051830 10:109887456-109887478 AAACAGAGGTAGATGGGGGATGG - Intronic
1076273198 10:129174571-129174593 CAAATGAGGGAGGAGGGAGAGGG + Intergenic
1076811322 10:132888076-132888098 TGAGAGAGGGAGAGGGGAGAGGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1080864572 11:36181869-36181891 AAACAGAGAGAGAGAGGAGACGG - Intronic
1081785683 11:45745245-45745267 CAGCCAAGGGAGACAGGAGAGGG + Intergenic
1082208371 11:49467102-49467124 CTATAGAGGGAGAGAGGAGAAGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083054086 11:59803085-59803107 CAACAGAAGGAAAAAGGAGATGG - Intergenic
1083616348 11:64028420-64028442 CTGCAGAGGGAGGAGGGAGAGGG + Intronic
1083865259 11:65450316-65450338 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865263 11:65450329-65450351 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865267 11:65450342-65450364 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865273 11:65450361-65450383 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865279 11:65450380-65450402 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1084139189 11:67212901-67212923 CAACACACGGGGATGGGAGATGG + Intronic
1084580886 11:70022517-70022539 CAAGCCTGGGAGACGGGAGATGG + Intergenic
1084582470 11:70032516-70032538 GAGCAGAGGGAGGCGGGAGAGGG + Intergenic
1084787248 11:71449522-71449544 CAACCGCGGGAAACTGGAGATGG - Intronic
1085116894 11:73937671-73937693 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085116904 11:73937702-73937724 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085116910 11:73937721-73937743 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1085159504 11:74327812-74327834 GGAAAGTGGGAGACGGGAGAGGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085754201 11:79190776-79190798 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754209 11:79190801-79190823 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754221 11:79190839-79190861 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754227 11:79190858-79190880 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754233 11:79190877-79190899 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754239 11:79190896-79190918 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754245 11:79190915-79190937 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754251 11:79190934-79190956 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754260 11:79190960-79190982 AGGGAGAGGGAGACGGGAGACGG - Intronic
1085754265 11:79190979-79191001 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754271 11:79190998-79191020 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754277 11:79191017-79191039 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754283 11:79191036-79191058 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754289 11:79191055-79191077 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754295 11:79191074-79191096 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754303 11:79191099-79191121 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085754311 11:79191124-79191146 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1085956686 11:81406513-81406535 AAACAGAGGGAGGGGGGATAGGG - Intergenic
1086075640 11:82848435-82848457 CTACAGAGGAAGACGGGATGGGG + Intronic
1086115630 11:83246550-83246572 GAGCAGAGAGAGACAGGAGAGGG + Intronic
1086411410 11:86548279-86548301 GAACAGAGGTAGAGGAGAGAAGG - Intronic
1086525413 11:87719635-87719657 AAACAGAGGGAGGAGGGAGGAGG + Intergenic
1086683825 11:89707312-89707334 GAAGAGGAGGAGACGGGAGAGGG - Intergenic
1086813705 11:91342420-91342442 CAACAGGGGGAGAGGAGAGAAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087820656 11:102707969-102707991 CAACAGACCCAGACTGGAGAAGG - Intergenic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088496615 11:110437788-110437810 TACCAGAGGGGGAAGGGAGAGGG - Intronic
1088799611 11:113293519-113293541 CAACAGAGGAAGGCGGGGGAGGG - Intergenic
1088907267 11:114164258-114164280 CGAGAGAGGGAGAAGGAAGAAGG - Intronic
1089469083 11:118706520-118706542 GGCCAGAGGGAGACAGGAGAGGG - Intergenic
1089526025 11:119097245-119097267 CACCAGAGTGAGACTGAAGATGG - Exonic
1089742773 11:120596456-120596478 CTTCAGAGAGAGACTGGAGAAGG + Intronic
1089770962 11:120802612-120802634 CAGCAGGGGGAGGCTGGAGAAGG + Intronic
1090147379 11:124339984-124340006 AGACAAAGGGATACGGGAGAAGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090941229 11:131389956-131389978 CAACAGAGAGAACTGGGAGAGGG + Intronic
1091112246 11:132980662-132980684 CCACCGAGGGAGAATGGAGATGG - Intronic
1091220401 11:133927097-133927119 CAAAAGAGAGAGACAGGATAGGG + Intronic
1091345716 11:134852521-134852543 ACAGAGAGGGTGACGGGAGAGGG - Intergenic
1091378391 12:41237-41259 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091378397 12:41256-41278 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091378403 12:41275-41297 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1091821214 12:3476560-3476582 TAAGAGAGAGAGATGGGAGAGGG - Intronic
1092062082 12:5559581-5559603 CAACATGTGGAGAGGGGAGAGGG + Intronic
1092181745 12:6451207-6451229 GGGCAGGGGGAGACGGGAGAAGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092487293 12:8914188-8914210 GAGGAGAGGGAGATGGGAGAAGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092850174 12:12619028-12619050 GGAAAGTGGGAGACGGGAGAGGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094328799 12:29270072-29270094 AAACAAAGGGAGACCTGAGAGGG - Intronic
1095962910 12:47846527-47846549 CAACAGGGAGAGAAGGGCGAGGG - Intronic
1096202948 12:49698810-49698832 CAAAAGAGAGAGACTGGAAATGG + Intronic
1096659331 12:53114148-53114170 CAACATAGGGAGAGGGGATGTGG - Intronic
1096663868 12:53149143-53149165 TAACAGAGGGGGAGGGGAGGGGG - Intergenic
1096751104 12:53759306-53759328 CAGCATAGGGAGAAAGGAGAAGG + Intergenic
1098229496 12:68358620-68358642 CAAGAGTGGGGGAAGGGAGAGGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100263884 12:92957795-92957817 CAATGGAGGGAGAAGGGGGAGGG - Intergenic
1100550771 12:95644487-95644509 CAACAGAGTGAGACTCCAGAAGG - Intergenic
1100570932 12:95842373-95842395 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570938 12:95842392-95842414 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570944 12:95842411-95842433 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570950 12:95842430-95842452 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570956 12:95842449-95842471 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570962 12:95842468-95842490 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570968 12:95842487-95842509 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1100570974 12:95842506-95842528 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1101272389 12:103161417-103161439 CAAGAGAGGGAGATGGTAGGTGG - Intronic
1101397696 12:104363028-104363050 CAGCAGAGGGAGATGGTAAAGGG + Intergenic
1101733530 12:107445892-107445914 GAAGACAGGGAGAGGGGAGAGGG - Intronic
1101802014 12:108030699-108030721 CAAGAGATGGAGATGGGACAGGG + Intergenic
1102164646 12:110796676-110796698 CAAGAGAGGGAGTAGGGAGCAGG + Intergenic
1102825926 12:115947924-115947946 CACCAGGGGGAGACGAGTGAAGG + Intergenic
1104258157 12:127157943-127157965 CAGCAAAGGGAGATAGGAGAGGG - Intergenic
1104301396 12:127568332-127568354 AAAGAGAGAGAGAGGGGAGAAGG + Intergenic
1104301426 12:127568543-127568565 GAAGAGAGGGAGAGAGGAGAGGG + Intergenic
1105644890 13:22306531-22306553 CAACAGATGTAGAGGGAAGATGG - Intergenic
1106679970 13:31999469-31999491 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1106701044 13:32228921-32228943 CAGCAGATGGAGGCAGGAGATGG + Intronic
1106993794 13:35457137-35457159 TAACAGGAGGAGATGGGAGAGGG - Intronic
1107274813 13:38666497-38666519 CATCATAGGGAGTGGGGAGAAGG - Intergenic
1107424198 13:40276405-40276427 CAACAGAAGGAGCCCGGTGAAGG + Intergenic
1107562504 13:41571274-41571296 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1107562508 13:41571287-41571309 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107562519 13:41571319-41571341 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107562525 13:41571338-41571360 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1107953525 13:45486284-45486306 GACCATCGGGAGACGGGAGACGG + Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1110242626 13:73285885-73285907 CAAGAGAGGCAAAGGGGAGAAGG - Intergenic
1111233964 13:85383741-85383763 TCACAGAGGGAGAAGGTAGAGGG - Intergenic
1112250451 13:97774481-97774503 CAACAGAGGCAGATGGAAGAAGG - Intergenic
1113363349 13:109652305-109652327 AAACAGACTGAGAAGGGAGAGGG - Intergenic
1113531903 13:111033281-111033303 AAACAGAGAGAGAGAGGAGAGGG + Intergenic
1113580568 13:111425793-111425815 CAAGAGTGAGAGACGGGAGAGGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115797793 14:36958722-36958744 CAACAGAGCCAGAAGGGAGGGGG + Intronic
1117450061 14:55841407-55841429 TAAGAGAGGGAGAGGGAAGAGGG - Intergenic
1117712307 14:58543807-58543829 GAAAATAGAGAGACGGGAGACGG - Intronic
1118341420 14:64896659-64896681 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341426 14:64896678-64896700 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341432 14:64896697-64896719 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341438 14:64896716-64896738 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341444 14:64896735-64896757 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341450 14:64896754-64896776 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341456 14:64896773-64896795 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118341462 14:64896792-64896814 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1118788491 14:69067008-69067030 GAACAGAGGAAGACGGGAAGTGG - Intronic
1119190155 14:72676005-72676027 CAATTGAGGGAGAAGGGAGAAGG - Intronic
1121321650 14:92995065-92995087 CACCACTGGGAGCCGGGAGAGGG + Intronic
1121496602 14:94396172-94396194 GAACAGAGGTAGAGGGAAGAGGG - Intergenic
1121549453 14:94787729-94787751 CAACAGTGGGGGACAGGAAACGG + Intergenic
1121642392 14:95494498-95494520 TAACAAAGAGAGACGGGAGGAGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123103151 14:105819160-105819182 AGGCAGAGGGAGACGTGAGAAGG - Intergenic
1125476492 15:40051173-40051195 CAACAGAGGAAGGAGGGAGGGGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126799268 15:52285452-52285474 GAGAGGAGGGAGACGGGAGAGGG - Intronic
1127018538 15:54717953-54717975 AAAGAGAGGGAGCCAGGAGAGGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127762770 15:62155335-62155357 CAGCAGAGGAATACTGGAGACGG + Intergenic
1127857038 15:62961478-62961500 CCACAAAGGGAAAGGGGAGAAGG + Intergenic
1128145032 15:65328326-65328348 CAACAGTGTGGGAAGGGAGAGGG + Exonic
1128891605 15:71336999-71337021 AATCAGAGAGAGAGGGGAGAGGG + Intronic
1129704193 15:77785240-77785262 CAAGAGAGGGAGATGTGGGAGGG - Intronic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1131442142 15:92467270-92467292 CAACAGAGATGGACGAGAGAGGG - Exonic
1131479552 15:92769334-92769356 GGGGAGAGGGAGACGGGAGAGGG + Intronic
1131479579 15:92769422-92769444 GGGGAGAGGGAGACGGGAGAGGG + Intronic
1132891686 16:2207930-2207952 CAACGGAAGTAGACAGGAGAAGG - Intronic
1133278366 16:4651498-4651520 GAACAGAGGAAGAGGTGAGAGGG + Intronic
1133485333 16:6214402-6214424 GAAGAGAGGGAGTGGGGAGAGGG + Intronic
1133606153 16:7390095-7390117 AAACAGAGCGAGAAGGGAGAGGG + Intronic
1133608723 16:7413327-7413349 CTACAGAGGAAGACTGGGGAAGG - Intronic
1134108316 16:11499310-11499332 GAAGGGAGGGAGAGGGGAGAGGG + Intronic
1134750316 16:16619849-16619871 CGGGAGAGGGAGACGGGAGGGGG + Intergenic
1134872780 16:17666871-17666893 CAACAGAAGGAGAGGGGGAAAGG - Intergenic
1134995142 16:18733749-18733771 CGGGAGAGGGAGACGGGAGGGGG - Intergenic
1135471167 16:22732481-22732503 CAACAGAGGGAGGCAGATGAGGG - Intergenic
1135500341 16:22990671-22990693 CAAAGAAGGGAGAAGGGAGAAGG - Intergenic
1136072415 16:27795834-27795856 TCACTGAGGGAGGCGGGAGATGG - Intronic
1136381510 16:29898189-29898211 CAGCCCAGGGAGAAGGGAGAGGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137718092 16:50611187-50611209 GGAGAGAGGGAGATGGGAGAGGG - Intronic
1138412654 16:56852213-56852235 CAACAGCGGGAGGCGGAGGATGG + Intergenic
1138650642 16:58459056-58459078 CAGCAGATGGAGATGGGAGGCGG - Intergenic
1138980053 16:62257296-62257318 ACAGACAGGGAGACGGGAGAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140341622 16:74170369-74170391 GAACTGGGGGAGACGGGATACGG + Intergenic
1140906569 16:79414375-79414397 CAAGAGAGGGACAAGAGAGAAGG + Intergenic
1141125257 16:81396595-81396617 CAAGAGAGGGAGCAAGGAGAGGG + Intergenic
1141642809 16:85351155-85351177 CTACAGAGGAGGCCGGGAGATGG + Intergenic
1141660361 16:85438047-85438069 CATCTGGGGGAGGCGGGAGAGGG + Intergenic
1141859194 16:86704917-86704939 CAGCAGAGGTAGAGGTGAGATGG + Intergenic
1141866196 16:86751771-86751793 CAACAGAGGGTGCCGGGGGAGGG - Intergenic
1141957560 16:87383158-87383180 CAAGAGAGGCAGACGGGGTAGGG - Intronic
1142753590 17:2002690-2002712 CAACAGAGAGAGACGGGCGTGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143033327 17:3980409-3980431 CCACGGAGGGAGACGGCAGGTGG - Intergenic
1143120355 17:4602834-4602856 GAAAAGAGGGAGCCAGGAGACGG + Intronic
1143452807 17:7046155-7046177 CAAAAGGGAGAGAGGGGAGATGG - Intergenic
1144147625 17:12413703-12413725 CAAGAGTGGGAGGCGGGTGAGGG - Intergenic
1144577380 17:16437567-16437589 CAACAGAGGTGGAGGGGAGGAGG - Intergenic
1144670262 17:17128864-17128886 AAACAGAGGGAGGCAAGAGAGGG - Intronic
1144763046 17:17718121-17718143 AAGCAGGGGGAGAGGGGAGAGGG - Intronic
1145158248 17:20556961-20556983 GGAAAGTGGGAGACGGGAGACGG - Intergenic
1145733429 17:27211250-27211272 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733441 17:27211288-27211310 AGGCAGAGGGAGACGGGAGAGGG - Intergenic
1145733452 17:27211326-27211348 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733460 17:27211351-27211373 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733466 17:27211370-27211392 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733472 17:27211389-27211411 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1145733478 17:27211408-27211430 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146499844 17:33354848-33354870 GGACAGAGGCAGAGGGGAGAGGG - Intronic
1148106782 17:45123178-45123200 CAAGAGAGGGTGAGAGGAGATGG - Intronic
1148118407 17:45192222-45192244 AAACAGGGGGTGACTGGAGAGGG - Intergenic
1148291203 17:46451826-46451848 CAACAGAGGAGGAATGGAGAGGG - Intergenic
1148313391 17:46669529-46669551 CAACAGAGGAGGAATGGAGAGGG - Intronic
1148702455 17:49597453-49597475 CAACACAGGGGAAGGGGAGATGG + Intergenic
1148743531 17:49906313-49906335 CCACAGAGGGACACAGGAGCTGG + Intergenic
1148771715 17:50071225-50071247 CAAGAGAGGGAATAGGGAGATGG + Intronic
1150369534 17:64624804-64624826 CAACAGAGCAAGACAGGGGAGGG + Intronic
1151345811 17:73500556-73500578 GAACAGAGGGAGGATGGAGAAGG - Intronic
1151430027 17:74056107-74056129 GAGAGGAGGGAGACGGGAGAAGG + Intergenic
1151503832 17:74513042-74513064 CAACACAGGCAGTCGGGGGAGGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1153444084 18:5152834-5152856 CCAGGGAGGGAGACGGGCGATGG + Intronic
1153565346 18:6413660-6413682 CAACAGAAGGATCCAGGAGATGG + Intronic
1154202248 18:12307951-12307973 CGCCAGAGGGAGACGCGAGTCGG - Intronic
1155433367 18:25785609-25785631 CAGCAGAGGCAGAGGGGAGAGGG - Intergenic
1156373223 18:36489855-36489877 AAAGAGAGGGAGAAGGGAGGAGG + Intronic
1157455725 18:47827460-47827482 AGACGGGGGGAGACGGGAGAGGG - Exonic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1158868961 18:61665752-61665774 CATCTGAGGGAGAAGGGGGAAGG - Intergenic
1160029345 18:75244957-75244979 CAAGAGAGAGAGATGGGGGAAGG - Intronic
1160080996 18:75727030-75727052 GAGCACAGGGAGAGGGGAGAAGG - Intergenic
1160616352 18:80132698-80132720 AGAAAGAGGGAGAGGGGAGAGGG - Intronic
1160765909 19:807824-807846 CAGCGGAGGGACAGGGGAGAGGG - Intronic
1161309587 19:3586339-3586361 GAACAGAGAGAGGAGGGAGAAGG - Intronic
1161349575 19:3784452-3784474 CTGCAGAGGGGGCCGGGAGAGGG + Intronic
1161582906 19:5090579-5090601 AAAGAGAGGGAGGGGGGAGAGGG - Intronic
1161737943 19:6002957-6002979 CAACACAGGGAGGAGGGAGCAGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163000215 19:14362475-14362497 CAACAAAGTGAGACCGGGGAAGG + Intergenic
1163921611 19:20295777-20295799 AAAGAGAGGCAGAGGGGAGAGGG - Intergenic
1164004328 19:21134883-21134905 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
1164066240 19:21720271-21720293 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066246 19:21720290-21720312 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066252 19:21720309-21720331 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066258 19:21720328-21720350 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066264 19:21720347-21720369 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164066270 19:21720366-21720388 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164231362 19:23290797-23290819 GGAAAGTGGGAGACGGGAGAGGG + Intergenic
1164532663 19:29060054-29060076 CAAGAATGGGAGACTGGAGAAGG + Intergenic
1165295595 19:34923009-34923031 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1165422986 19:35731661-35731683 CAGCAGAGGCAGAGAGGAGATGG + Intronic
1166017630 19:39994851-39994873 CAAGAGAGTGAGGAGGGAGATGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166502257 19:43350612-43350634 CAACAGAGGAAAACTGGAAATGG + Intergenic
1166507850 19:43382844-43382866 CAACAGAGGAAAACTGGAAATGG - Intergenic
1166818310 19:45560498-45560520 CAGGAGAGAGAGAAGGGAGATGG - Intronic
1166881240 19:45931388-45931410 CAACAGAGGGGGATGGAAGAAGG - Intergenic
1167399524 19:49255632-49255654 CCACAGAGGGAGATCGGGGATGG + Intergenic
1167547939 19:50140418-50140440 GTGGAGAGGGAGACGGGAGACGG - Intergenic
1167668319 19:50835855-50835877 CAACAGAGGGAGGCGGCTGCAGG - Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168402793 19:56095604-56095626 CAACAGAGGAAGGCAGGAGAAGG - Intronic
925057469 2:866408-866430 CCACAGGGAGAGACGGGGGAGGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
926909959 2:17843361-17843383 CATGAGAAGAAGACGGGAGAGGG + Intergenic
927148933 2:20184858-20184880 GAACAGAGGGACACTGGAGACGG - Intergenic
927783201 2:25955377-25955399 CAACAGGGGGAGGCAGGAGGCGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928178556 2:29051690-29051712 CAAGAGAGGGAAGTGGGAGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929780324 2:44953010-44953032 CAAAAGCGGGAGAAGGGAGTGGG + Intergenic
929864778 2:45708802-45708824 CAACAGAGGGAGAAGGCACCTGG - Intronic
929894078 2:45943386-45943408 CAAAAGAGGGATAGGGCAGAGGG + Intronic
930209006 2:48615471-48615493 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209012 2:48615490-48615512 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209018 2:48615509-48615531 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930209024 2:48615528-48615550 AGGGAGAGGGAGACGGGAGAGGG + Intronic
930608597 2:53517377-53517399 AAAGGGAGGGAGAGGGGAGAGGG - Intergenic
930768413 2:55108397-55108419 CAGGAGAGGGAGAAGGGTGAAGG + Intronic
931107995 2:59078770-59078792 CAACAAAAGGAGGAGGGAGAAGG - Intergenic
931153345 2:59599492-59599514 CTAAAGAGTGAGACTGGAGAAGG + Intergenic
931609791 2:64086733-64086755 AAAAAGAGGGAGATGGGAGTTGG + Intergenic
931751856 2:65338148-65338170 CGGGAGAGGGAGACGGGAGAGGG - Intronic
931751863 2:65338168-65338190 AGGGAGAGGGAGACGGGAGACGG - Intronic
931751868 2:65338187-65338209 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751874 2:65338206-65338228 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751880 2:65338225-65338247 CGGGAGAGGGAGACGGGAGAGGG - Intronic
931751884 2:65338238-65338260 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751890 2:65338257-65338279 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751896 2:65338276-65338298 AGGGAGAGGGAGACGGGAGAGGG - Intronic
931751902 2:65338295-65338317 AGGGAGAGGGAGACGGGAGAGGG - Intronic
932132101 2:69197085-69197107 AAAAAGAGGGAGACGGGTGATGG - Intronic
932568175 2:72922498-72922520 CATCACAGGGAGATGGGTGAGGG - Intronic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
934784865 2:96997681-96997703 CATGAGAGAGAGACGGGAGGGGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936158371 2:110064631-110064653 GCAAAGAGGGAGACGGGAGAGGG + Intergenic
936186290 2:110306695-110306717 GCAAAGAGGGAGACGGGAGAGGG - Intergenic
936254900 2:110903211-110903233 GACCAGAGGGAGAGGGGAGAAGG + Intronic
936344346 2:111663795-111663817 CAGCAGAGGGAGACGGCATTTGG - Intergenic
937308725 2:120888152-120888174 CTCCAGAGGGAGAAGGGAGTCGG + Intronic
937838995 2:126506832-126506854 GAACAGGGGGAAAAGGGAGAGGG - Intergenic
938079544 2:128362457-128362479 CAGTAGATGGAGACGGCAGATGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938720463 2:134063381-134063403 TGGGAGAGGGAGACGGGAGAGGG - Intergenic
938785856 2:134628742-134628764 CAGCAAAGGGAGACGGCACATGG - Intronic
939670086 2:145000428-145000450 CAACAGAGAGAGAGGGGGGGTGG + Intergenic
939770561 2:146310797-146310819 AGACAGAGGGAGAAGAGAGAAGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940890956 2:159034711-159034733 TAACAGAGGAAGATGGGAGGAGG - Intronic
941024944 2:160448301-160448323 GCAAAGAGGGAGACGGGAGAGGG - Intronic
941226723 2:162858664-162858686 TCACAGAGGGAGACAGGTGAGGG + Intergenic
942129641 2:172865591-172865613 AAACAGAGGAAGAGGGCAGAGGG - Intronic
942687193 2:178545751-178545773 AATCAGGGGGAGAAGGGAGAAGG - Intronic
942937431 2:181575115-181575137 CATCAGTGGGAGAAGGGAGAAGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943773166 2:191741093-191741115 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773172 2:191741112-191741134 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773178 2:191741131-191741153 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773186 2:191741156-191741178 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773198 2:191741195-191741217 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943773204 2:191741214-191741236 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
943863051 2:192893487-192893509 GCAAAGAGGGAGACGGGAGAAGG - Intergenic
944202986 2:197127856-197127878 GAACAGAGGGACATGTGAGAAGG - Intronic
945090544 2:206172597-206172619 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090550 2:206172616-206172638 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090556 2:206172635-206172657 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090562 2:206172654-206172676 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090568 2:206172673-206172695 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090574 2:206172692-206172714 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090580 2:206172711-206172733 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090592 2:206172748-206172770 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090604 2:206172785-206172807 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090612 2:206172810-206172832 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090618 2:206172829-206172851 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090626 2:206172854-206172876 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090634 2:206172879-206172901 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090642 2:206172904-206172926 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090650 2:206172929-206172951 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090658 2:206172954-206172976 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090664 2:206172973-206172995 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090670 2:206172992-206173014 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090674 2:206173005-206173027 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090680 2:206173024-206173046 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090684 2:206173037-206173059 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090690 2:206173056-206173078 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090696 2:206173075-206173097 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090702 2:206173094-206173116 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090708 2:206173113-206173135 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090716 2:206173138-206173160 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945970611 2:216227534-216227556 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970617 2:216227553-216227575 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970623 2:216227572-216227594 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970629 2:216227591-216227613 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970635 2:216227610-216227632 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970639 2:216227623-216227645 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970645 2:216227642-216227664 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970651 2:216227661-216227683 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970657 2:216227680-216227702 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970663 2:216227699-216227721 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970669 2:216227718-216227740 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945970675 2:216227737-216227759 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
945974387 2:216259208-216259230 CAACAGAGGGAGCAGGCAGAGGG - Exonic
946025883 2:216671396-216671418 CAACACAGTGAGGCGGCAGAAGG + Intergenic
946061574 2:216946297-216946319 AAAGAGAGGAAGACGGGAGAAGG - Intergenic
946315276 2:218907274-218907296 GAATAGAGGGAAACAGGAGAAGG + Intergenic
946488657 2:220126199-220126221 AAAAAGAGGGAGACAGGAGGAGG + Intergenic
947004810 2:225498846-225498868 CATTAGAGGGAAAAGGGAGATGG + Intronic
947424657 2:229972539-229972561 GAACAGAGGGAGAGAGGAGGAGG + Intronic
947891890 2:233630688-233630710 CAAGAGAGAGACAGGGGAGATGG + Intronic
948129992 2:235593074-235593096 GAAGTGAGGGAGAGGGGAGAGGG + Intronic
948535937 2:238646897-238646919 CAACTGAGGGAGAGGAGAGCAGG + Intergenic
1168798288 20:626877-626899 TAACAGAGGGAGACGGGCAGTGG - Intergenic
1168912664 20:1462173-1462195 CAAAAGTGGGGGATGGGAGAGGG + Intronic
1169085316 20:2822522-2822544 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085322 20:2822541-2822563 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085330 20:2822566-2822588 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085334 20:2822579-2822601 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085338 20:2822592-2822614 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085344 20:2822611-2822633 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085350 20:2822630-2822652 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085356 20:2822649-2822671 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085362 20:2822668-2822690 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085368 20:2822687-2822709 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085374 20:2822706-2822728 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085380 20:2822725-2822747 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085386 20:2822744-2822766 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085392 20:2822763-2822785 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085398 20:2822782-2822804 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085404 20:2822801-2822823 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085410 20:2822820-2822842 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085416 20:2822839-2822861 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085422 20:2822858-2822880 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085428 20:2822877-2822899 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085434 20:2822896-2822918 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085440 20:2822915-2822937 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085446 20:2822934-2822956 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085452 20:2822953-2822975 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085458 20:2822972-2822994 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085464 20:2822991-2823013 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085492 20:2823076-2823098 CCGTGGAGGGAGACGGGAGAGGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1169289401 20:4335794-4335816 AAAGAGAGAGAGACGGGAGTGGG - Intergenic
1170684399 20:18555973-18555995 CAGCTGGGGGTGACGGGAGACGG + Intronic
1170786353 20:19470974-19470996 CCTCAGAGGGAGACGGCACAAGG + Intronic
1172127293 20:32632229-32632251 CAGGAGTGGGAGAGGGGAGAAGG + Intergenic
1172720721 20:36998958-36998980 TAAAAGAGGGAGAGGGGAAATGG + Intronic
1173073243 20:39790505-39790527 GAACAGAGGAAGAAGGGAAAAGG + Intergenic
1173126461 20:40340528-40340550 CAACAGAGAGAGAAGACAGATGG + Intergenic
1173494535 20:43508983-43509005 CAAGAGAGGCTGACGGCAGAAGG + Intronic
1173861862 20:46289057-46289079 AAATAGAGGGAGAGGGGAGTAGG - Intronic
1174033179 20:47647387-47647409 CAACAGAAGGAGAAGCCAGAGGG - Intronic
1176024369 20:62978344-62978366 CAGCAGAGGGAGATGGGGGTGGG - Intergenic
1176719062 21:10378851-10378873 GGAGAGAGAGAGACGGGAGAGGG - Intergenic
1176719069 21:10378877-10378899 GGAGAGAGAGAGACGGGAGAGGG - Intergenic
1177773499 21:25543607-25543629 CAAGAGAGGGAGTCGGGTGTGGG + Intergenic
1178075341 21:29010655-29010677 GACCATGGGGAGACGGGAGAGGG - Intronic
1178381923 21:32117142-32117164 CAAAAGAGGGGGACAGGAAAAGG + Intergenic
1178921082 21:36738677-36738699 CAACAGTGGGAGGTGGGAGGTGG - Intronic
1179195007 21:39156532-39156554 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195015 21:39156557-39156579 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195023 21:39156582-39156604 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195029 21:39156601-39156623 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179195037 21:39156626-39156648 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1179532404 21:42028867-42028889 CAGCATAGGGAGGCTGGAGAGGG + Intergenic
1180109215 21:45640165-45640187 CAGCAGGGGGACAGGGGAGAGGG + Intergenic
1180300305 22:11031871-11031893 GGAGAGAGAGAGACGGGAGAGGG - Intergenic
1181437929 22:22921192-22921214 CCCCAGAGGGAGAGGGGAGAGGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182043828 22:27259120-27259142 CAACAGAGAGAGAAGGGAGAAGG - Intergenic
1182372287 22:29819720-29819742 CAGCAGCAGGAGACGGGGGAGGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183270122 22:36856720-36856742 CAGCAGAGGGAGACAGAAAAGGG + Intergenic
1183653451 22:39171875-39171897 AAACACAGGCAGACGGGGGATGG - Intergenic
1183871894 22:40746373-40746395 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871900 22:40746392-40746414 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871906 22:40746411-40746433 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871912 22:40746430-40746452 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871920 22:40746455-40746477 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871926 22:40746474-40746496 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871932 22:40746493-40746515 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871938 22:40746512-40746534 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871944 22:40746531-40746553 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871950 22:40746550-40746572 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871956 22:40746569-40746591 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871960 22:40746582-40746604 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183871966 22:40746601-40746623 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1184193240 22:42908951-42908973 AAAAAGAGGAAGAGGGGAGAGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184345711 22:43911419-43911441 CAACATAGGGAGGGTGGAGAAGG - Intergenic
1184857980 22:47156871-47156893 CGACAGAAGGAGACGGCAAATGG - Intronic
1184959373 22:47917934-47917956 AAAGAGAGGGAGGAGGGAGAGGG - Intergenic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
949950083 3:9221761-9221783 CAAAAGATGGAGTCAGGAGAGGG - Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950457872 3:13103369-13103391 CCACAGAGGTGGAGGGGAGAGGG - Intergenic
950753919 3:15156098-15156120 GAACAGAGGGGAAGGGGAGAAGG + Intergenic
950844761 3:16003892-16003914 AAACAGAGGAAGTGGGGAGAAGG + Intergenic
951715814 3:25644707-25644729 CATCAGGGGGTGATGGGAGATGG + Intronic
951718062 3:25670178-25670200 CAATTGAGGGAGAGGGGAGATGG + Intergenic
951743363 3:25948784-25948806 GAAATGAGGGAGACGGGAGAGGG - Intergenic
951775587 3:26307073-26307095 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
952849147 3:37713481-37713503 CCACAGAGGGAGGAGGGAGGAGG + Intronic
953609217 3:44433593-44433615 CCAGGGAGGGAGACTGGAGAAGG + Intergenic
953834204 3:46329054-46329076 CAACTGAAGGAGCCGGGGGAGGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955206472 3:56900123-56900145 CAACAAAGGGAGTTGGGAGGTGG - Intronic
956399340 3:68860483-68860505 CAACAGAGAGAGAGAGGAAAAGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959417090 3:106088543-106088565 TAACAGAGTGTGATGGGAGATGG + Intergenic
960073466 3:113458163-113458185 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073470 3:113458176-113458198 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073474 3:113458189-113458211 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073478 3:113458202-113458224 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073482 3:113458215-113458237 GAGGAGAGGGAGACGGGAGAGGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961371374 3:126433927-126433949 CACCAGAGGCAGCTGGGAGAGGG + Intronic
962044215 3:131738513-131738535 CAACAGATGGGGAAGGGAGGGGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963897502 3:150702943-150702965 AAAGAGAGGGGGAGGGGAGAGGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964108363 3:153063159-153063181 CAGCAGAGGGAGAGGGGAAGTGG - Intergenic
964300766 3:155282879-155282901 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
964493138 3:157258500-157258522 CAAAAGAGGGAGAAGGAACATGG - Intergenic
964874117 3:161346870-161346892 CCACGGAGGGAGAAGGGAGCAGG + Intronic
965853511 3:173060275-173060297 CCAAAGATGGAGACGTGAGAAGG + Intronic
966324129 3:178735267-178735289 GGACAGAGGGACACAGGAGATGG + Intronic
966617371 3:181926658-181926680 GGAAAGTGGGAGACGGGAGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967040003 3:185683263-185683285 TACCAGAGGCTGACGGGAGAGGG + Intronic
967812181 3:193769682-193769704 CAGCAGAGGGAGAGGGGCAAGGG + Intergenic
967984058 3:195082380-195082402 CACCAGAGGGAGAGAGAAGATGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969228727 4:5815449-5815471 CCTCATAGGGAGACGGGAAATGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970874556 4:20854491-20854513 GAAGAGTGGGAGACAGGAGAGGG + Intronic
971016784 4:22497109-22497131 GAACAGAGGGAGACAACAGAGGG + Intronic
971251415 4:24975986-24976008 AAAAAGAAGGAGAAGGGAGAGGG + Intronic
971282224 4:25250211-25250233 AAGAAGAGGGAGAGGGGAGAGGG + Intronic
971751391 4:30654097-30654119 CAACTGAGGGAAATGGCAGAAGG - Intergenic
972350680 4:38233506-38233528 GAGGAGAGTGAGACGGGAGAGGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973263199 4:48185847-48185869 AGGGAGAGGGAGACGGGAGAGGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
973810270 4:54562582-54562604 AATCAGAGGGAGCTGGGAGATGG + Intergenic
975658926 4:76669029-76669051 CATCACATGGAGACGGGATAGGG + Intronic
975683803 4:76900189-76900211 CAAGAGAGAGAGAGAGGAGAAGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976599959 4:86928916-86928938 CAAAAGAGGGAGAAGAGAGAAGG - Intronic
976871253 4:89796373-89796395 GAACTGAGGGACAAGGGAGAGGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978742457 4:112152605-112152627 CAACAGAGACAGAAAGGAGATGG - Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979425699 4:120562792-120562814 CACTAGAGAGAGAGGGGAGAGGG - Intergenic
979858366 4:125662988-125663010 CTTCATAGGGAGAGGGGAGAAGG + Intergenic
980716661 4:136637519-136637541 AAACAGAGTGGGAGGGGAGAGGG - Intergenic
982015097 4:151145545-151145567 CAGCAAAGGGAGACAGGAGTGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982166473 4:152617990-152618012 AAACAGAGGCAGACTGGAAAGGG - Intergenic
982306930 4:153942355-153942377 CAACATAGTGAGATGGAAGAGGG - Intergenic
982560708 4:156925752-156925774 AAAAAGAGAGAGACGGGGGATGG + Intronic
983060822 4:163158061-163158083 CAACAGAGGTTGGTGGGAGAAGG + Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984388249 4:179092757-179092779 CAAAAGAGGAAGACATGAGAAGG + Intergenic
984451224 4:179905568-179905590 TAACAGAGAGAGGAGGGAGAGGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984953456 4:185023313-185023335 AGACAGAGGGAGACAGGAGCGGG - Intergenic
985205141 4:187527378-187527400 TAATAGAGGGGGAAGGGAGAGGG + Intergenic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
986122756 5:4857429-4857451 CATCAGAGGGTGATGGGAGATGG - Intergenic
986122831 5:4857784-4857806 CATCAGAGGGTGCTGGGAGATGG - Intergenic
987799827 5:22680095-22680117 CAACCTAGGGGGAAGGGAGAAGG + Intronic
989104591 5:37849612-37849634 CCACAGAGCGAGGCGGCAGAGGG + Intergenic
989491011 5:42053552-42053574 CAACAGAGTGAGCTAGGAGAAGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991073996 5:62514590-62514612 AGGGAGAGGGAGACGGGAGAGGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992016047 5:72576322-72576344 CAACAGAGCAAGACTGAAGAAGG + Intergenic
992088476 5:73298410-73298432 GAACAGGGGGACACGGGAGAGGG - Intergenic
992415976 5:76551843-76551865 GCAAAGAGGGAGACGGGAGAGGG + Intronic
995926551 5:117381841-117381863 CAACATAGAGAGGCAGGAGAGGG - Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
997104138 5:130999088-130999110 CAACAGAGAAAGAAGGCAGAGGG - Intergenic
997934817 5:138101179-138101201 GAACAGAGGGAGCAGAGAGAAGG + Intergenic
998679697 5:144453192-144453214 CACCTGAGGGAAAAGGGAGATGG - Intronic
998807518 5:145933391-145933413 GAACAGCGGGAGAAGGGAGGTGG + Intergenic
1000041247 5:157486676-157486698 CAGCAGAGGGAGGAGGGAGTGGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1001494032 5:172175386-172175408 GGAGAGAGGGAGAAGGGAGAAGG + Intronic
1001628725 5:173158644-173158666 CAACAAAGGCACACGGGAGAAGG - Intronic
1002043036 5:176528269-176528291 CAACAGAGGGAGAGGAGATTGGG + Exonic
1003024464 6:2541947-2541969 AACCAGAGGGAGATGGGGGAAGG + Intergenic
1003075859 6:2983159-2983181 CTACAGAGTGAGACGGGGGTTGG - Intergenic
1003093469 6:3123612-3123634 CCACAGGGGGAAAGGGGAGATGG - Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003515371 6:6813541-6813563 GAACAGTGGGAGGTGGGAGAAGG + Intergenic
1003924098 6:10860673-10860695 CAAGAGAGGGAGTTGGGGGAAGG + Intronic
1003998519 6:11568375-11568397 GAACAGAGGGGGAAGGAAGAAGG + Intronic
1004354795 6:14921562-14921584 CAAATGAGGGAGAAGGGGGAAGG + Intergenic
1004755630 6:18607737-18607759 CAAGAGAGGAAGAAGGGAGAAGG + Intergenic
1005167764 6:22944738-22944760 CATCAGAGGAAGATGGAAGAGGG + Intergenic
1005206824 6:23414499-23414521 CAACAGAAGGACACTGGAGAGGG + Intergenic
1005743873 6:28817914-28817936 CAACAGAGAGAGAAGGGAAGGGG + Intergenic
1005836965 6:29717712-29717734 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836971 6:29717731-29717753 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836977 6:29717750-29717772 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836983 6:29717769-29717791 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836989 6:29717788-29717810 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005836995 6:29717807-29717829 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837001 6:29717826-29717848 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837007 6:29717845-29717867 CGGGAGAGGGAGAGGGGAGAGGG - Intergenic
1005837012 6:29717858-29717880 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837018 6:29717877-29717899 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837024 6:29717896-29717918 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1005837030 6:29717915-29717937 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1006507918 6:34502357-34502379 AAACAGAGGGAAACAGGGGAAGG + Intronic
1007079007 6:39085565-39085587 AAACACAGGGAGACAGGAGATGG - Intronic
1007751202 6:44073031-44073053 CAGCAGAGGCAGGCGGGTGAGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008926787 6:56895995-56896017 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926793 6:56896014-56896036 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926799 6:56896033-56896055 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926805 6:56896052-56896074 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926811 6:56896071-56896093 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926817 6:56896090-56896112 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1008926823 6:56896109-56896131 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1010716611 6:79237528-79237550 AGAGAGAGGGAGAAGGGAGAAGG + Intergenic
1013277311 6:108598205-108598227 CAATTGAGGGAGATGGAAGAGGG - Intronic
1013348137 6:109282099-109282121 GAAGGGAGGGAGAAGGGAGACGG - Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013638207 6:112048659-112048681 GAACAGAGGGCCATGGGAGACGG + Intergenic
1013703432 6:112801883-112801905 CGAGAGAGAGAGAGGGGAGAGGG + Intergenic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1013758024 6:113483816-113483838 CAAAAGAGGGAGCCTGGAGATGG - Intergenic
1014740606 6:125144143-125144165 AAACAGAGGGAGAAGAAAGAAGG - Intronic
1014764410 6:125390105-125390127 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764416 6:125390124-125390146 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764422 6:125390143-125390165 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764428 6:125390162-125390184 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014764434 6:125390181-125390203 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1014987443 6:128029202-128029224 CAAGAGAGGGAGACAGGAGAGGG - Intronic
1015093242 6:129384670-129384692 CAACAGGGGTAGACTGGAGATGG + Intronic
1015240074 6:131012183-131012205 CAACTGAGGGAGACTCTAGATGG + Intronic
1015877456 6:137837442-137837464 GAACAGTGGGAGACAGGCGAGGG - Intergenic
1016063597 6:139655748-139655770 CAACAGAGAGGGAAAGGAGAAGG + Intergenic
1016497137 6:144676429-144676451 AAACAGAGAAAGAGGGGAGAGGG - Intronic
1016953019 6:149599572-149599594 AGAGAGAGGGAGAGGGGAGAGGG - Intronic
1017228927 6:152051585-152051607 GCACAGAGGGAGAGGAGAGATGG - Intronic
1018169171 6:161130658-161130680 CAACAGATGTTCACGGGAGATGG - Exonic
1019117881 6:169779958-169779980 CAGCCGAGGGAGACTGGAGCTGG - Intronic
1019119550 6:169792358-169792380 CAACAGATTGAGAAGGGAGGAGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019551815 7:1606878-1606900 GAACAGGGGGAGGAGGGAGAGGG - Intergenic
1019559703 7:1649895-1649917 CAGGAGAGGTAGAGGGGAGATGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021469140 7:20981459-20981481 GAAAAGAGAGAGGCGGGAGAGGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022479704 7:30734732-30734754 CAGCAGAGGGAGCTAGGAGAGGG - Intronic
1024576880 7:50771571-50771593 TAACACAGGGAGAGGGCAGATGG - Intronic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026442793 7:70458644-70458666 CAACAAAGGGAGAAGGGAGGTGG - Intronic
1028058047 7:86273318-86273340 ACACAGAGAGAGAGGGGAGAAGG + Intergenic
1028431340 7:90750117-90750139 ACACAGAGGGAGTGGGGAGAAGG + Intronic
1028595849 7:92545844-92545866 AGGGAGAGGGAGACGGGAGACGG + Intergenic
1029477304 7:100792579-100792601 CAGCAGAGGTGGACGGCAGAGGG - Intronic
1030288137 7:107847559-107847581 GGAAAGAGGGAGAGGGGAGAGGG - Intergenic
1030396736 7:108995453-108995475 CAAGAGAGAGAGATGGGAGAAGG + Intergenic
1031003596 7:116446586-116446608 CATCAGAGGGAGACGTAAGGAGG - Intronic
1031519202 7:122742556-122742578 CAACAGAGAGATAAGTGAGAGGG + Intronic
1033007249 7:137579985-137580007 CATCAGAGTGAGAAGGGAGCAGG - Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033864523 7:145672596-145672618 GAAAAGAGGGAAAAGGGAGAAGG + Intergenic
1034256525 7:149727753-149727775 CAACAGAGGGAGCCGGGAGTTGG - Intronic
1034420247 7:150986782-150986804 CAGGAGAGGGAGACAGGAGGAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035052094 7:156004906-156004928 CAACTGAGGTAGCCGGGGGATGG + Intergenic
1035386207 7:158474772-158474794 CCACTGAGGGAGTCGGGAGTGGG + Intronic
1035976483 8:4317582-4317604 CAAGAGAGAGAGAGGAGAGAGGG + Intronic
1036483142 8:9154867-9154889 AAAGAGAGGGAGACGGGAGAGGG + Intronic
1038565849 8:28619533-28619555 CAGCAGTGGGAGAGGGGAGCTGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038687715 8:29733800-29733822 CATCAGAGGGTGAAGGGAGAGGG - Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039710154 8:40047934-40047956 CAAGAGTGGGAGCAGGGAGAGGG + Intergenic
1040053035 8:43034001-43034023 AGGGAGAGGGAGACGGGAGAGGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040967654 8:53100634-53100656 CAACAGATGGACACGGGAAGGGG + Intergenic
1041357863 8:57021193-57021215 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1041357869 8:57021212-57021234 AGGGAGAGGGAGACGGGAGAGGG - Intergenic
1041357877 8:57021237-57021259 AAGGAGAGGGAGACGGGAGAGGG - Intergenic
1042581531 8:70284563-70284585 TAACAAAGGGGGATGGGAGAAGG - Intronic
1042581567 8:70284834-70284856 GGAGAGAGGGAGAAGGGAGAAGG + Intronic
1043267666 8:78286802-78286824 AAAAAAAGGGAGAGGGGAGAGGG + Intergenic
1043958713 8:86390694-86390716 GACGAGAGGGAGACGGGAGAGGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045332388 8:101166532-101166554 CAACAGAGGGATGTGGGCGAGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046703444 8:117426195-117426217 CAACAGAGGGAGACCAAAGAAGG - Intergenic
1046889641 8:119408414-119408436 TACCAGAGGGAGAAGGGAGGCGG + Intergenic
1047033622 8:120911476-120911498 CAATAGAGAAAGAAGGGAGAAGG - Intergenic
1047696194 8:127406187-127406209 CAACAGAGTGAGATGAAAGAAGG + Intergenic
1048283389 8:133122267-133122289 TAACAGATGGAGAGGAGAGAGGG + Intronic
1048383116 8:133885843-133885865 CAAGAGAGAGAGACTGGAGAAGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051593349 9:18798702-18798724 CAACAGAGAGAGACGCCTGATGG + Intronic
1052274655 9:26663629-26663651 GGAAAGCGGGAGACGGGAGACGG - Intergenic
1053139513 9:35673976-35673998 CAACAGAGGGAGCCAGGGGCTGG - Exonic
1053206135 9:36188147-36188169 CCACAGATGGAGACTAGAGAGGG - Intergenic
1055294567 9:74820953-74820975 AAGCAGAGGGAGATGGTAGAGGG + Intronic
1055580745 9:77703883-77703905 AGGGAGAGGGAGACGGGAGAGGG + Intergenic
1056367276 9:85918270-85918292 GAAGAGAGAGAGAGGGGAGAGGG - Intergenic
1056544897 9:87605504-87605526 GAATAGAGTGAGAGGGGAGAAGG - Intronic
1057367987 9:94442054-94442076 ATACAGAGGAAGACGGGAGAAGG - Intronic
1058540943 9:106012006-106012028 CAAAGGAGGGAGAGAGGAGATGG - Intergenic
1059432629 9:114259207-114259229 CAAAAGAGGGACGAGGGAGAGGG + Intronic
1061440933 9:130602921-130602943 CAAAAGTGGGGAACGGGAGAAGG - Intronic
1061754754 9:132804623-132804645 GAGCAGAGGGACACGGGAGGGGG - Intronic
1061995612 9:134181313-134181335 CATCAGAGAGAGCAGGGAGAGGG + Intergenic
1062133342 9:134912172-134912194 CAACAGCTGGAGATGGGGGAAGG + Intronic
1062407898 9:136406110-136406132 CTACAGAGGGAGACCACAGACGG + Intronic
1185647493 X:1625511-1625533 AAAGAGAGAGAGAGGGGAGAAGG + Intronic
1185918747 X:4065492-4065514 GGACAGAGGGAGAAGGGTGAGGG + Intergenic
1186080124 X:5922052-5922074 AATCAGAGGGAAAAGGGAGAAGG + Intronic
1186532607 X:10312425-10312447 AAAGAGAGGGAGGGGGGAGAGGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190252932 X:48740865-48740887 CAACAGAGTGAGACTCGAAAGGG + Intergenic
1190712743 X:53081753-53081775 CAGCAGTGGGGGATGGGAGAAGG + Intergenic
1192106769 X:68325610-68325632 AGGGAGAGGGAGACGGGAGAGGG - Intronic
1192106775 X:68325629-68325651 CGGGAGAGGGAAACGGGAGAGGG - Intronic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1192360062 X:70433806-70433828 CATCAGGGGGAGATGGGAGGAGG + Intergenic
1194609066 X:96018232-96018254 CAACAGAGGGAGAAGAGAGGGGG + Intergenic
1195233949 X:102878558-102878580 CGAGAGAGGGAGAAGAGAGATGG + Intergenic
1196790490 X:119459850-119459872 CAACAATAGGAGACTGGAGAAGG + Intergenic
1197199127 X:123733498-123733520 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1197199131 X:123733511-123733533 GGGGAGAGGGAGACGGGAGAGGG - Intergenic
1197401363 X:125995474-125995496 CAACATTGGGAGAAGGGAGGAGG + Intergenic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1198466738 X:136910204-136910226 AAAGAGAAGGAGATGGGAGAGGG - Intergenic
1199924859 X:152451416-152451438 CAGCAAAGGGGGAGGGGAGAAGG - Intergenic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic