ID: 951800193

View in Genome Browser
Species Human (GRCh38)
Location 3:26587207-26587229
Sequence CCTCACAGGCACAAGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951800193_951800198 8 Left 951800193 3:26587207-26587229 CCTTCTCCCTTGTGCCTGTGAGG No data
Right 951800198 3:26587238-26587260 ACACAGTCTCTGAGTGCACATGG No data
951800193_951800199 25 Left 951800193 3:26587207-26587229 CCTTCTCCCTTGTGCCTGTGAGG No data
Right 951800199 3:26587255-26587277 ACATGGTCCCAGTCCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951800193 Original CRISPR CCTCACAGGCACAAGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr