ID: 951802776

View in Genome Browser
Species Human (GRCh38)
Location 3:26614832-26614854
Sequence CAAGTTCTACAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951802772_951802776 8 Left 951802772 3:26614801-26614823 CCAACTAACAGAAATATTGTGCT No data
Right 951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG No data
951802771_951802776 13 Left 951802771 3:26614796-26614818 CCAGACCAACTAACAGAAATATT No data
Right 951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951802776 Original CRISPR CAAGTTCTACAGAAGGAGGA AGG Intergenic
No off target data available for this crispr