ID: 951806492

View in Genome Browser
Species Human (GRCh38)
Location 3:26649928-26649950
Sequence CTGGATAAGTAGAGGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951806492_951806496 4 Left 951806492 3:26649928-26649950 CCTCTTTCCCTCTACTTATCCAG 0: 1
1: 0
2: 3
3: 20
4: 336
Right 951806496 3:26649955-26649977 ATTTCATCTTTTTAAGACCCAGG 0: 1
1: 0
2: 3
3: 33
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951806492 Original CRISPR CTGGATAAGTAGAGGGAAAG AGG (reversed) Intronic
900960458 1:5915768-5915790 CTGGAGAATTAGTGGGACAGTGG - Intronic
901676172 1:10886911-10886933 CTGGATACTGAGAGGGAATGAGG + Intergenic
902527279 1:17067432-17067454 CTGGCTAGGTAGATGGGAAGGGG + Exonic
902722869 1:18315736-18315758 CTAGATAAGTGGATGGTAAGTGG + Intronic
905277850 1:36830504-36830526 CCGTATAAGAAGAGGAAAAGAGG + Intronic
905532050 1:38687584-38687606 CTGTGTAAGGAGAGGGTAAGGGG - Intergenic
905859390 1:41339520-41339542 CATGTTAAGTAGAGAGAAAGGGG - Intergenic
905882078 1:41470487-41470509 CTGGAAAGCTAGAGGGATAGAGG + Intergenic
907495475 1:54841382-54841404 TTGGAGCAGTGGAGGGAAAGTGG + Intronic
908083192 1:60602591-60602613 CTGGACAACTATAGGGAGAGTGG - Intergenic
909337261 1:74490223-74490245 CTGAATAAGAGAAGGGAAAGAGG - Intronic
910212195 1:84804697-84804719 CTGTTTCAGTAGAGTGAAAGGGG - Intergenic
910500704 1:87886987-87887009 CTGAATAAGAGGAGGGAGAGAGG - Intergenic
910541943 1:88369536-88369558 CGGGATAAGAAGGGGGAAATGGG - Intergenic
913070177 1:115291637-115291659 CTGGTTCAGAAGAGGGCAAGAGG - Intronic
913216145 1:116622125-116622147 CTGGAAAAGTAGATGTAAAATGG - Intronic
913409683 1:118537402-118537424 CTGGATAATTTAAAGGAAAGAGG - Intergenic
914918624 1:151833061-151833083 GTGGATGAGTAGTGAGAAAGAGG + Intergenic
915755813 1:158258139-158258161 CTGAAAAATTAGAAGGAAAGGGG - Exonic
916570491 1:166021825-166021847 CTGGTGAAGTAGAGGAAAGGAGG + Intergenic
917365205 1:174223751-174223773 CTGGACAAGTAGAGGTACACAGG + Intronic
918344347 1:183593231-183593253 CAGGAGAAGGGGAGGGAAAGTGG - Intronic
918356617 1:183710872-183710894 GTGGATAACTAGAAGGAAAAGGG + Intronic
920534694 1:206729872-206729894 CTGGATGAGTAGAGGAAGGGAGG + Intronic
921125098 1:212170512-212170534 CTTTATAAGAAGAGGAAAAGGGG + Intergenic
921931347 1:220756820-220756842 CTGGATGGAAAGAGGGAAAGAGG + Intronic
1062795340 10:341047-341069 CAGGAGAAGTAGAGGGACACGGG + Intronic
1063380635 10:5583385-5583407 GTGGGAAAGGAGAGGGAAAGGGG + Intergenic
1063728272 10:8664921-8664943 TTGGAGAGGGAGAGGGAAAGAGG + Intergenic
1064898653 10:20269485-20269507 CTGGCTAAGCAGAGAGGAAGGGG + Intronic
1066477373 10:35761021-35761043 CAGGGTATGTAGAGGGGAAGAGG + Intergenic
1068330028 10:55551900-55551922 TTAGACAAGTAAAGGGAAAGTGG - Intronic
1069112763 10:64467548-64467570 CCAGGTATGTAGAGGGAAAGGGG + Intergenic
1069571568 10:69497548-69497570 ATGGAGAAATAGGGGGAAAGTGG - Intronic
1070481253 10:76884775-76884797 AGGGAAAAGGAGAGGGAAAGGGG + Intronic
1071779906 10:88832807-88832829 CTGGAGCAGAGGAGGGAAAGAGG - Intronic
1073075979 10:100826240-100826262 CGGGTTAAGTAGAGGAGAAGGGG - Intronic
1073275021 10:102302252-102302274 GTGGAAAGGGAGAGGGAAAGGGG + Intronic
1074139414 10:110658805-110658827 CTAGTTGAGGAGAGGGAAAGAGG - Intronic
1075220961 10:120584167-120584189 GTTGAGAAGTAGAGGAAAAGAGG - Intronic
1075829663 10:125396872-125396894 CTGGGAAACTAGTGGGAAAGTGG + Intergenic
1076381783 10:130028523-130028545 CTTGAGAAGTAAAGGCAAAGAGG + Intergenic
1077451205 11:2647023-2647045 CTGAATAAGAATAGTGAAAGTGG + Intronic
1078261513 11:9713825-9713847 CTGGAGATTTACAGGGAAAGTGG + Intronic
1078375724 11:10791790-10791812 CTGGCCAAGCAGAGGGCAAGGGG - Intergenic
1078528464 11:12118541-12118563 CTGGCAAAGTAGAGTGGAAGGGG - Intronic
1078856013 11:15206892-15206914 CTGGAAAAGTAGAGACAAATGGG - Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1080394281 11:31875589-31875611 CTACATAATTAGAGGGAGAGTGG - Intronic
1080441500 11:32298910-32298932 CAGAATAAGTGGAGTGAAAGAGG - Intergenic
1080563910 11:33490602-33490624 CTGGCTAATTAGAAGTAAAGTGG - Intergenic
1083215962 11:61220116-61220138 GTGGATAAGTTCAGGGACAGTGG - Intergenic
1083218846 11:61238942-61238964 GTGGATAAGTTCAGGGACAGTGG - Intergenic
1083235053 11:61345834-61345856 CTGGACAAGGTGAAGGAAAGGGG - Intronic
1084713535 11:70859239-70859261 GTAGATAAGTAGATGGATAGTGG + Intronic
1084765115 11:71303226-71303248 CTGGAAGAGTGGAGCGAAAGAGG - Intergenic
1086219727 11:84428147-84428169 AAGGAGAAGTAGAGGGTAAGGGG - Intronic
1086882340 11:92163344-92163366 TTGGATAATTAGAAAGAAAGAGG - Intergenic
1088822224 11:113466160-113466182 CTAAATAACTAGAGGGACAGGGG + Intronic
1088976138 11:114817946-114817968 CTGGGGAAGGAGAGGGAGAGGGG + Intergenic
1089204194 11:116745744-116745766 CTGGAGAAGTTAGGGGAAAGTGG + Intergenic
1089560581 11:119341257-119341279 CTGAAAAAGCAGATGGAAAGGGG + Exonic
1089647424 11:119889415-119889437 CTGGGTAAGGTGAGGGAAAGGGG - Intergenic
1090475356 11:127015239-127015261 CTGGATAGGAAGATGGAAAGAGG - Intergenic
1090743258 11:129686058-129686080 CTCCAGAAGAAGAGGGAAAGGGG + Intergenic
1090816445 11:130301108-130301130 CTAGATAGGTAGAAGGAAATGGG + Intronic
1091047376 11:132336731-132336753 CTGGATGTGATGAGGGAAAGGGG + Intronic
1091096859 11:132831532-132831554 ATGTCTAAGTAGAGGGAAAATGG - Intronic
1091128852 11:133127113-133127135 ATGGATCAAAAGAGGGAAAGGGG - Intronic
1091463793 12:666118-666140 CTGGCTGAATAGAGGGAAACAGG + Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092071591 12:5635942-5635964 CTTGATAAGTAGAGGCAAGAAGG + Intronic
1094395574 12:30001966-30001988 CTGGATAACCTGAGGGAATGAGG + Intergenic
1096596072 12:52696356-52696378 CTGAAGAAGGTGAGGGAAAGGGG - Exonic
1096889993 12:54760171-54760193 CTGGAGATAAAGAGGGAAAGTGG - Intergenic
1097261416 12:57722385-57722407 CAGGATAAGAAAAGGGATAGAGG + Intergenic
1098275725 12:68809064-68809086 CTGGATCAGCAGAGAAAAAGTGG - Intronic
1098389710 12:69956605-69956627 CTGGGCAAGCAGAGGGAGAGAGG - Intronic
1098521533 12:71439673-71439695 GGGGACAAGTGGAGGGAAAGTGG + Intronic
1098717125 12:73843968-73843990 CTGGAGAAGTAGTGGGAATAGGG - Intergenic
1099292441 12:80788628-80788650 TTGGATAGGTAAAGGAAAAGGGG + Intergenic
1099760158 12:86911268-86911290 CTGGACGTGTTGAGGGAAAGAGG + Intergenic
1100524498 12:95406850-95406872 GTGGATAGGTAGGGGTAAAGAGG + Intergenic
1100540663 12:95554301-95554323 CTGGAAAGGCAGAGGGAGAGAGG + Intergenic
1100605453 12:96148765-96148787 CTGGAAAAATAGATGGAATGAGG + Intergenic
1101281773 12:103264853-103264875 CTAGATAAATAAAGGAAAAGAGG - Intronic
1101745904 12:107541330-107541352 CTGGACAATGAGAGGGAATGGGG + Intronic
1102734700 12:115148789-115148811 TGGGGAAAGTAGAGGGAAAGGGG - Intergenic
1102742769 12:115222850-115222872 CTGGTTCAGTACAGGGAGAGTGG + Intergenic
1103540703 12:121664436-121664458 CTGCATGAGTAAAGGCAAAGAGG + Intronic
1105219879 13:18315602-18315624 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1105393456 13:20004698-20004720 CTGGATAAGTAGAAAGTAAGAGG - Intronic
1106011472 13:25828035-25828057 CTGAAGAAGTAGCGGGAATGTGG - Intronic
1106679601 13:31996654-31996676 CTGGAAGAGCAGATGGAAAGTGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107543010 13:41410782-41410804 CTGGAAATGTGGAGAGAAAGAGG + Intergenic
1109950338 13:69493644-69493666 CTGGGTCAGTAGTGGGGAAGAGG + Intergenic
1110382511 13:74870031-74870053 CTGGAGAAGAAGAGAGATAGGGG + Intergenic
1110757430 13:79192079-79192101 GTGGAAAAGTAGTGGTAAAGTGG - Intergenic
1112105328 13:96233721-96233743 CTTGATAGGAAGAGGGAATGTGG + Intronic
1112624240 13:101084448-101084470 CTGGGTAAGGAAAGGGAGAGTGG - Intronic
1114734840 14:25033624-25033646 AAGGATAAGTAGAGTTAAAGAGG - Intronic
1115555354 14:34540983-34541005 ATTGGTATGTAGAGGGAAAGAGG + Intergenic
1115558554 14:34562110-34562132 ATTGGTATGTAGAGGGAAAGAGG - Intronic
1117098499 14:52321635-52321657 CTGGGTAAGTAGAGAAAATGTGG - Intronic
1117520872 14:56550215-56550237 CTGGATAAGTAGTTGGCAAGAGG - Intronic
1120413574 14:84191343-84191365 CTGAATAGTTAGAGGGAATGTGG - Intergenic
1120587082 14:86325586-86325608 CTGCATATGTAGAGAGAAATAGG + Intergenic
1120881096 14:89416376-89416398 CTGGATAAGTTGGGGGACGGCGG - Intronic
1120886347 14:89454889-89454911 CTGGAGAAGGAGAGGGAGTGGGG + Intronic
1121816009 14:96929097-96929119 ATGGATAGGTGGATGGAAAGGGG - Intronic
1121816050 14:96929282-96929304 ATGGATAGGTAGATGGATAGGGG - Intronic
1124721954 15:32118126-32118148 CTTGATAAGAAGAGGAAGAGAGG + Intronic
1124815784 15:32990690-32990712 CTGGGTAATTATAAGGAAAGAGG + Intronic
1125271927 15:37948969-37948991 TGAGAAAAGTAGAGGGAAAGGGG + Intronic
1125388295 15:39163119-39163141 CTGAAGGAGTAGAGAGAAAGAGG - Intergenic
1125404971 15:39342487-39342509 CTGGAAGAGTGGAGGAAAAGGGG - Intergenic
1126961148 15:53995878-53995900 GTGGAGAAGTAGAGAGAGAGAGG + Intergenic
1127341090 15:58044824-58044846 TTGGATGAGCAGAGGGAAAAGGG + Intronic
1127540961 15:59938636-59938658 GTAGAAAAGTAGAGGGAAGGGGG - Intergenic
1127988276 15:64092322-64092344 CTAGATATGTAGAGGGTCAGAGG - Intronic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128576924 15:68782735-68782757 CTGGATTAGAAGAGGGGAAGAGG - Intronic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133924363 16:10181772-10181794 CTAGAGAGGGAGAGGGAAAGCGG - Intronic
1136034865 16:27531465-27531487 CTGAGCCAGTAGAGGGAAAGGGG - Intronic
1136065227 16:27754139-27754161 TTGGAGAAGCAGAGGAAAAGGGG - Intronic
1137453531 16:48599360-48599382 CTGGCAAAATAGAGGGTAAGAGG + Intronic
1137559036 16:49491592-49491614 CTGGCTAGGTGGAGGGAAAGGGG + Intronic
1137766001 16:50978025-50978047 CTGGCTAGGTGCAGGGAAAGGGG + Intergenic
1138118830 16:54381915-54381937 CTGGATAAGTTTAATGAAAGTGG - Intergenic
1141612902 16:85193183-85193205 ATGGAGAAATAGAGGGAATGTGG - Intergenic
1142045729 16:87924141-87924163 TCGGAGAAGAAGAGGGAAAGTGG - Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1144260504 17:13515029-13515051 ATGGAAATGAAGAGGGAAAGGGG + Intronic
1144808753 17:17985164-17985186 CTGGGTAAGCAGACAGAAAGAGG - Intronic
1144962493 17:19053014-19053036 CTGGATATGGTCAGGGAAAGAGG + Intergenic
1144972668 17:19121506-19121528 CTGGATATGGTCAGGGAAAGAGG - Intergenic
1146596344 17:34172465-34172487 ATGGATAATTAGATGGACAGGGG + Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146948841 17:36891997-36892019 GTGGAGAAGCAGAGTGAAAGAGG + Intergenic
1147045234 17:37746340-37746362 CTGTAGAAGAACAGGGAAAGGGG + Intergenic
1150460575 17:65346801-65346823 CGGGATGAGTACAGTGAAAGAGG + Intergenic
1150936990 17:69647332-69647354 CTGGAAAAGAAGAGAGCAAGGGG + Intergenic
1151788407 17:76287984-76288006 TTGGGTTAGTAGAGGGAACGGGG - Intronic
1151851622 17:76694069-76694091 CCAGATAAGTAGATGGAAGGGGG - Intronic
1152108857 17:78346024-78346046 CTGGATCAGGAGAGGACAAGTGG - Intergenic
1153321550 18:3778799-3778821 ATGGATAAGCAGAGGGGATGAGG + Intronic
1153392242 18:4575093-4575115 CTGGATAATTTAAAGGAAAGAGG - Intergenic
1153980349 18:10303428-10303450 CTGCAGAAGTAGAGAGAAATGGG - Intergenic
1156261802 18:35451457-35451479 AAGGATAAGGAGAGGGAAAAGGG + Intronic
1157502542 18:48201611-48201633 CTGGAAAGATGGAGGGAAAGAGG - Intronic
1158321230 18:56267010-56267032 CCTGAAAAGTAGATGGAAAGTGG - Intergenic
1159700340 18:71618593-71618615 CTGCTTAAGGAGAGGGAATGAGG - Intergenic
1162412533 19:10515089-10515111 CCGGCTAAGTCGTGGGAAAGGGG + Intronic
1163171258 19:15532822-15532844 CTGGATGAGGGGAGGGCAAGAGG - Intronic
1163229031 19:15987356-15987378 GTAGATTGGTAGAGGGAAAGGGG + Intergenic
1164446705 19:28323834-28323856 TTTGATAAGTAAAGGTAAAGAGG + Intergenic
1165369320 19:35394000-35394022 GTGTATAAGTAGAAGGATAGTGG + Intergenic
1168336349 19:55599624-55599646 CTGGGAAAGGAAAGGGAAAGAGG - Intronic
1168549219 19:57279615-57279637 ATGGATAAGTGACGGGAAAGAGG - Intergenic
925588486 2:5487043-5487065 CTTTTTAAGCAGAGGGAAAGAGG - Intergenic
925814243 2:7732292-7732314 CTGGATAGGTAAAGGGGAGGCGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926664517 2:15505891-15505913 CTGGACAAGAAGAGTGAAAAAGG + Intronic
929233534 2:39584182-39584204 CTGAACAACAAGAGGGAAAGAGG - Intergenic
929493907 2:42422898-42422920 CTGGATAAGAGGAGGAAAGGGGG - Intronic
930217223 2:48709142-48709164 AAGGGTAAGTGGAGGGAAAGTGG + Intronic
931128432 2:59303674-59303696 CTGCATAAATATAGTGAAAGAGG + Intergenic
934080936 2:88467331-88467353 CTGGGAAAGCAGAGGGATAGGGG + Intergenic
934184168 2:89656914-89656936 CTGGAAAAGTAGATGTAAAATGG + Intergenic
934294456 2:91731052-91731074 CTGGAAAAGTAGATGTAAAATGG + Intergenic
935532158 2:104247672-104247694 CAGGATGAGCAAAGGGAAAGAGG + Intergenic
936156704 2:110051633-110051655 GTGGATAAATAGAGGCAGAGAGG + Intergenic
936187988 2:110319811-110319833 GTGGATAAATAGAGGCAGAGAGG - Intergenic
937842135 2:126534641-126534663 GTGGTTAAGGAGAGGAAAAGGGG + Intergenic
939828665 2:147046370-147046392 CAGGAACAATAGAGGGAAAGAGG - Intergenic
941517059 2:166493118-166493140 ATGGCAAAGTAGAAGGAAAGTGG - Intronic
941798694 2:169630417-169630439 CTTGATAATAAGAGGGAAAGTGG + Intronic
942414425 2:175743984-175744006 TTGGAGAAGTATTGGGAAAGAGG + Intergenic
942573822 2:177341547-177341569 CAGGGAAAGTACAGGGAAAGTGG + Intronic
944435142 2:199680991-199681013 CTGGAGAAGTGGAAGAAAAGTGG + Intergenic
944587228 2:201183057-201183079 CTGGAAAAGGGGAGGGAAAAAGG + Exonic
945381860 2:209149950-209149972 TTGGATAAGGAGAGGGAAAGTGG - Intergenic
946115790 2:217460904-217460926 TTGTAAAAGTGGAGGGAAAGAGG + Intronic
1168976073 20:1966773-1966795 CTGGATTGGGAGAGAGAAAGAGG - Intergenic
1170405605 20:16032668-16032690 ATGGATGAGAAGAGGGAAGGAGG + Intronic
1170444134 20:16407539-16407561 CCGGATAACCAGAGGGCAAGAGG + Intronic
1172292089 20:33783981-33784003 ATGGAGAAGTGGAGGGAAAAGGG - Intronic
1172375738 20:34438451-34438473 CTGGGTAAGAAGAGGGGAAAAGG - Intronic
1174439748 20:50541076-50541098 CAGGAGAAGTAGAGGTGAAGAGG + Intronic
1175604921 20:60304786-60304808 CTGGAGAACTACAGGGCAAGGGG + Intergenic
1177107920 21:16983689-16983711 CTAGATAATTCTAGGGAAAGGGG + Intergenic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1180817484 22:18800492-18800514 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1181203673 22:21234814-21234836 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1182728339 22:32467014-32467036 CTGGAGAAGGACAGGGAGAGAGG - Intergenic
1183004658 22:34891086-34891108 CTGGGTAATTTAAGGGAAAGAGG - Intergenic
1183022570 22:35039095-35039117 CTTGATAAATAGAGTGAGAGAGG - Intergenic
1183762626 22:39837384-39837406 ATTGATTATTAGAGGGAAAGGGG - Intronic
1184044960 22:41967252-41967274 AAGGATAAGAAGAGGGATAGGGG + Intergenic
1184275803 22:43409049-43409071 ATGAAAAAATAGAGGGAAAGAGG - Intergenic
1203223247 22_KI270731v1_random:60602-60624 CTGGAAAAGTAGATGTAAAATGG + Intergenic
1203267582 22_KI270734v1_random:26218-26240 CTGGAAAAGTAGATGTAAAATGG - Intergenic
949134502 3:546733-546755 TTGGACAAGAAGAAGGAAAGGGG + Intergenic
949338317 3:3001379-3001401 CTGGATAAGGAGTGAGTAAGAGG + Intronic
950955586 3:17050150-17050172 CTGTATAAGGAGAGAGATAGGGG - Intronic
951588336 3:24237544-24237566 GTGGAAAAGGAGAGGGGAAGAGG - Intronic
951806492 3:26649928-26649950 CTGGATAAGTAGAGGGAAAGAGG - Intronic
951958183 3:28281808-28281830 TTGGCTAAGTATAGGGAAACTGG + Intronic
952577173 3:34789477-34789499 CTGGAACAGCAGAGGGACAGTGG - Intergenic
953075990 3:39570778-39570800 CTGGAGAAGTGAAGGGGAAGTGG - Intergenic
954865185 3:53722940-53722962 CTGGAGAGGTAGAGGGAAACGGG - Intronic
955071808 3:55577954-55577976 CTGGAGAGGGAGAGAGAAAGGGG + Intronic
955523678 3:59799478-59799500 CATGAGAAGTAGAGGAAAAGGGG + Intronic
955551453 3:60089489-60089511 GTGGATAAATGGACGGAAAGAGG + Intronic
956390081 3:68762445-68762467 CTGAATAGGTAGAAGGAAATGGG + Intronic
957640742 3:82850186-82850208 AAGGATAAGAAGAGGAAAAGTGG - Intergenic
958471599 3:94527824-94527846 CGTGATAAGTAAAGAGAAAGAGG + Intergenic
958686591 3:97406172-97406194 CTGAAGAAATAGAGGGCAAGAGG + Intronic
958777585 3:98504855-98504877 CTGGGTAAGTAGAGTGAGCGGGG - Intronic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959056550 3:101573425-101573447 CTGGATAAATACTGAGAAAGGGG + Intergenic
960456142 3:117874578-117874600 ATGGATAACTAGTGGGAAACTGG - Intergenic
961025522 3:123552306-123552328 CTGGATAGGGAAAGAGAAAGAGG + Intronic
961705863 3:128784691-128784713 CTGGATATGAAGGGGGAAAAGGG - Intronic
961943379 3:130659923-130659945 CAAGAGAAGGAGAGGGAAAGAGG - Intronic
962024291 3:131531005-131531027 GTGGATATGTAGTTGGAAAGAGG - Intergenic
963668497 3:148221656-148221678 CTGGATAAGTATCTGGAAAAGGG - Intergenic
963853167 3:150227624-150227646 CTAGGTAAGAAGAGGGAAAGTGG + Intergenic
964429181 3:156586761-156586783 TTGGATAAATAGTGGCAAAGGGG + Intergenic
964712176 3:159682892-159682914 CTTGATAAGAAGGGTGAAAGTGG + Intronic
965406165 3:168272397-168272419 GTGGACATGTAGAGAGAAAGTGG + Intergenic
965541015 3:169871364-169871386 GTGGAAAAGAAGAAGGAAAGGGG + Intergenic
965548619 3:169940602-169940624 ATGAATAAAAAGAGGGAAAGAGG - Intergenic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
966770409 3:183498981-183499003 CAGAAAAAGAAGAGGGAAAGTGG - Intronic
967180703 3:186901189-186901211 CTTGATATTTAGAGGGAAATGGG - Intergenic
967606711 3:191455694-191455716 CAGGACTGGTAGAGGGAAAGTGG + Intergenic
967608002 3:191471066-191471088 CTGGATTAGAGGAGGGTAAGAGG - Intergenic
969033527 4:4231957-4231979 CTTTATAAGAAGAGGAAAAGAGG - Intergenic
969799816 4:9554826-9554848 CTGGAAGAGGACAGGGAAAGGGG - Intergenic
970548015 4:17149208-17149230 CTGTATCAGTAGAGTGAAAATGG + Intergenic
970964655 4:21914242-21914264 CTGTTAAAGTAGTGGGAAAGAGG + Intronic
971173278 4:24256157-24256179 CTGGATAAAAAGAGGAATAGTGG - Intergenic
972169260 4:36324945-36324967 CTGGAGAGGAAGAGAGAAAGGGG + Intronic
974415569 4:61602244-61602266 CTGGAAAAGTAGGGATAAAGAGG - Intronic
975267663 4:72390008-72390030 CAGGAAAAGGAGAGGGGAAGCGG + Intronic
977878853 4:102181414-102181436 CAGGACAAGTAGAGGGCAAAGGG - Intergenic
978189145 4:105893494-105893516 ATGGATGATTAGAGAGAAAGGGG - Intronic
980896827 4:138868354-138868376 TTGGATAAGGATAGGAAAAGAGG + Intergenic
982435433 4:155379365-155379387 CTTGGTAAGGAGAGGGAAAGCGG - Intergenic
982903447 4:161037882-161037904 CTGGAGAAATAGAGTGAAGGAGG + Intergenic
983163788 4:164450127-164450149 ATGGAGAAATAGAGAGAAAGAGG + Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985785401 5:1890613-1890635 CAGGAGAAGGAGAGTGAAAGGGG - Intergenic
986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG + Intronic
989031744 5:37126493-37126515 CCGGTAAAGGAGAGGGAAAGAGG - Intronic
989064919 5:37450567-37450589 CTGAATAAGTAAATGGATAGTGG - Intronic
990184379 5:53197753-53197775 CTGGAGAAGTAGCAGGAAAGAGG - Intergenic
991920557 5:71652654-71652676 CTGGAGAACTAAAGGAAAAGAGG - Exonic
992160090 5:73992663-73992685 ATGGATAAGGAGCTGGAAAGAGG + Intergenic
992825008 5:80540134-80540156 CTGGATCAGAAGAGGAAAAAGGG - Intronic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
994520834 5:100832828-100832850 CTTGACACATAGAGGGAAAGAGG - Intronic
994625416 5:102212730-102212752 CAGGAGAAGTAGAGTGAAAGAGG + Intergenic
994649320 5:102506718-102506740 CTGATGAAGTAGAGGAAAAGGGG - Intergenic
997313089 5:132906601-132906623 CTAGGAAGGTAGAGGGAAAGAGG + Intronic
997580754 5:135015338-135015360 CTGCAGAGCTAGAGGGAAAGGGG + Intergenic
998102652 5:139447080-139447102 CTGGGTAATTATAAGGAAAGAGG - Intergenic
998199238 5:140106913-140106935 CTGAATACGTAGATGGAACGTGG - Intergenic
1000113320 5:158129826-158129848 CTCCATATGTTGAGGGAAAGAGG - Intergenic
1001923233 5:175617083-175617105 CCGGAGAAGTAGAGTGAAAGGGG + Intergenic
1001973106 5:175972736-175972758 CAGGATGTGTAGAGGGACAGGGG + Intronic
1002244330 5:177871047-177871069 CAGGATGTGTAGAGGGACAGGGG - Intergenic
1003113525 6:3267881-3267903 CTGGTGAAGGAGAGGCAAAGTGG + Intronic
1004739961 6:18450005-18450027 TTGGATAAGAAAAGGGAAATTGG - Intronic
1005730752 6:28694490-28694512 CAGAAGAAGTTGAGGGAAAGGGG + Intergenic
1006752783 6:36389030-36389052 CTGGAAAAGCTGAGGTAAAGTGG + Intergenic
1007309548 6:40934633-40934655 CTGGAGGAGGAGAGGGAATGGGG + Intergenic
1010801053 6:80176099-80176121 CTGGATTAGCAGAAGGAAATGGG + Intronic
1012008565 6:93749770-93749792 TTGGATAAATAGAGAGGAAGAGG + Intergenic
1013547785 6:111176168-111176190 GTGGATTAGTAGAGGGAGAAGGG + Intronic
1014298078 6:119644767-119644789 CAGTACAAGTAGAAGGAAAGTGG - Intergenic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1015518982 6:134112970-134112992 CAGGATACGTTGAGGGACAGTGG - Intergenic
1015666654 6:135638056-135638078 CTGGATAAGGTGATGGAAAATGG + Intergenic
1015746119 6:136511580-136511602 GTGGAGAACTAGAGGGAATGTGG + Intronic
1017757195 6:157539555-157539577 CTATTTAAGAAGAGGGAAAGAGG + Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018309513 6:162493328-162493350 CTGGGTTTGTAGAGGCAAAGAGG + Intronic
1018673120 6:166195778-166195800 CTGGAATAGTAGAGGGAATGCGG + Intergenic
1022323171 7:29305885-29305907 GGGGAAAAGGAGAGGGAAAGAGG - Intronic
1022853676 7:34293981-34294003 ACTGATAAGTAGAGGGAAAATGG - Intergenic
1024762226 7:52612435-52612457 TTGTATAAGAAGAGGGAATGAGG - Intergenic
1026216146 7:68350876-68350898 TTGGATCAGTAGAAGGAGAGAGG + Intergenic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026502292 7:70952916-70952938 CTGGGAAACTAGAGGCAAAGAGG + Intergenic
1026938987 7:74275761-74275783 CTGGAGATGGAGAGGGAAACAGG - Intergenic
1029126844 7:98300635-98300657 CTGGGGAGGTAGAGGGATAGCGG - Intronic
1029361314 7:100090384-100090406 CTGTTTAACTAGAGGGGAAGGGG - Exonic
1029363601 7:100103516-100103538 CTTGGTCAGTAGAGGGAAAGAGG + Exonic
1029498559 7:100912526-100912548 CTGGCTGACAAGAGGGAAAGTGG - Intergenic
1030715769 7:112805154-112805176 TTGGATAAGCAGGAGGAAAGGGG - Intergenic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1032662283 7:133998112-133998134 TTGAAAAAGTAGAGGGAAACAGG + Intronic
1035837826 8:2773622-2773644 CTGGTGAAGTATAGTGAAAGTGG - Intergenic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037540805 8:19868721-19868743 GTGGATAAGGACAGGAAAAGAGG - Intergenic
1037547967 8:19941646-19941668 TTGGGTGAGTAGAGTGAAAGTGG - Intronic
1038247106 8:25868902-25868924 ATGTATAAGTGGAGAGAAAGAGG - Intronic
1038555020 8:28505176-28505198 CTGGATCAGTAGAGGGATGGAGG - Intronic
1038827225 8:31017256-31017278 CTGGAGAAGTAGTGGTAAATGGG - Intronic
1040520959 8:48175741-48175763 CTGGTTGAGTGGAGGAAAAGGGG + Intergenic
1040714887 8:50238999-50239021 CTGGAGAAGTTGTGAGAAAGGGG + Intronic
1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG + Intronic
1041417574 8:57628877-57628899 CAGGATAAGCAGAAGGGAAGAGG - Intergenic
1041692608 8:60703750-60703772 CTGGCTCAATAGAGGGAAGGTGG - Intronic
1041816832 8:61982599-61982621 CTCGATGAGAAGAGGGAATGTGG + Intergenic
1042509965 8:69600927-69600949 CTGGAGAGGTAGATGGAATGAGG - Intronic
1044850645 8:96424197-96424219 CTGGAGAAGAAGAGGGTGAGGGG + Intergenic
1046885217 8:119359597-119359619 ATGGAAAAGAAGAGGGAAAATGG - Intergenic
1047327470 8:123853602-123853624 GTGGATGAGTAGAGAAAAAGGGG + Intronic
1048163500 8:132041635-132041657 CTGGATCAGCACAGGGAAATTGG + Exonic
1048167593 8:132077138-132077160 ATGGATAAGTGGAAGGAAAGAGG + Intronic
1048187827 8:132260531-132260553 CTAGATAAGAAGAGGAAGAGAGG + Intronic
1049941602 9:551253-551275 CTGGACAAAAAGAGGGAAACAGG - Intronic
1052223250 9:26053167-26053189 CTGACTAGGCAGAGGGAAAGGGG + Intergenic
1054834964 9:69667708-69667730 ATGGTGTAGTAGAGGGAAAGTGG - Intronic
1055431178 9:76245831-76245853 CAGGATAATTAAAGGGAGAGAGG + Intronic
1057766534 9:97924674-97924696 ATGGGGAAGGAGAGGGAAAGAGG - Intergenic
1058140399 9:101351898-101351920 ATGGATAAGGAGAGGGGAAATGG + Intergenic
1058151082 9:101464173-101464195 CCTGATTGGTAGAGGGAAAGGGG + Intergenic
1058640686 9:107081058-107081080 CTGATTAAGCAGAAGGAAAGAGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058860114 9:109108059-109108081 CTGGATAAGAGGAGGGAACTGGG - Intronic
1058987387 9:110220832-110220854 CTGGAGAAGTAGTGGGAGGGGGG + Intergenic
1059633700 9:116153041-116153063 AGGGAAAAGAAGAGGGAAAGAGG + Intergenic
1060361766 9:122965838-122965860 CTGGACAATTAGCGGGAAAGGGG + Intronic
1060467052 9:123916225-123916247 CTGGAAAAATACAGGGAATGTGG - Intronic
1060698631 9:125731460-125731482 CTGGGGAAGTAGAGGGGATGGGG - Intergenic
1060917276 9:127398615-127398637 CTGGGTCAGGAGGGGGAAAGGGG - Intronic
1061507456 9:131039503-131039525 CTGCATAAGTGCAGGGAGAGGGG + Intronic
1061808136 9:133147866-133147888 CAGGACCAGCAGAGGGAAAGAGG - Intronic
1187028874 X:15465096-15465118 CTGCAAAAGTAGAGGAAAGGGGG - Intronic
1187746779 X:22417940-22417962 GTGTATAATTAAAGGGAAAGAGG - Intergenic
1187912111 X:24120594-24120616 CTGGATAATTAGAGGGACAGAGG - Intergenic
1192340070 X:70257073-70257095 CTGGATATCTAGGGAGAAAGTGG + Intergenic
1192603183 X:72486382-72486404 GTGGAGCAGTAGAGGGAAAGGGG - Intronic
1194163375 X:90483432-90483454 ATGGATAGGTAGCTGGAAAGGGG + Intergenic
1195462262 X:105140840-105140862 GTGGATATGTAGAGGTGAAGAGG + Intronic
1198492650 X:137158057-137158079 CGGGAAAAGTAGAGGAAAGGTGG + Intergenic
1198588144 X:138145786-138145808 CAGAATAAGTAGAGGAAGAGAGG - Intergenic
1199595760 X:149504818-149504840 ATGGATGAATAGATGGAAAGAGG + Intronic
1199600505 X:149538907-149538929 CTAGATAAGGGGAGGGACAGAGG + Intergenic
1199650083 X:149941034-149941056 CTAGATAAGGGGAGGGACAGAGG - Intergenic
1200097268 X:153670136-153670158 AGGGAGAAGCAGAGGGAAAGGGG + Intronic
1200509644 Y:4061157-4061179 ATGGATAGGTAGCTGGAAAGGGG + Intergenic
1201649654 Y:16271380-16271402 ATGGATAAGTAAAGAGAATGTGG - Intergenic