ID: 951806914

View in Genome Browser
Species Human (GRCh38)
Location 3:26655372-26655394
Sequence GACATTATGGTGCCTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951806914 Original CRISPR GACATTATGGTGCCTCTCAC AGG (reversed) Intronic
903259491 1:22123731-22123753 GACATTATTCTGCCTCCCAGAGG + Intronic
905929856 1:41779369-41779391 GATATGATAGTGCCTATCACAGG + Intronic
908522472 1:64957438-64957460 CACATATTCGTGCCTCTCACTGG + Intronic
908897970 1:68922754-68922776 ACCATTATTCTGCCTCTCACAGG - Intergenic
911992396 1:104717399-104717421 GACTTTATGGTGGCACTAACAGG + Intergenic
912560893 1:110550831-110550853 GGCATTATTCTGCCTCTCACTGG + Intergenic
916862844 1:168824699-168824721 GACATTAGGATACCTCTCAGAGG - Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1068781270 10:60921371-60921393 GAAAGGATGGTGCCTCTGACAGG + Intronic
1073343509 10:102764183-102764205 TGACTTATGGTGCCTCTCACTGG + Intronic
1074011536 10:109486580-109486602 GACATTATAGTGCATTTTACAGG - Intergenic
1075193085 10:120329425-120329447 GAAATTAAGTGGCCTCTCACTGG + Intergenic
1075425232 10:122337012-122337034 GAAATTAATGTGCCACTCACAGG - Intronic
1076521904 10:131086533-131086555 CACACTATGGTGGCTCCCACAGG + Intergenic
1077008130 11:368864-368886 GACAGTGTCGTGCCTCTCACCGG - Intergenic
1080035656 11:27707577-27707599 AACTTCTTGGTGCCTCTCACTGG - Intronic
1080769611 11:35328297-35328319 GACATTAGGGTCCCTCTGATGGG - Intronic
1081698046 11:45132065-45132087 GTCATTCTTGTGCATCTCACTGG + Intronic
1087093163 11:94296125-94296147 CACATAATGGTACATCTCACTGG + Intergenic
1097742333 12:63258080-63258102 AACATTATGCTGCCTTACACTGG - Intergenic
1098592682 12:72232216-72232238 GACTTTACTGTGCTTCTCACAGG + Intronic
1100079223 12:90827383-90827405 GCCATAATGGTGCCTACCACAGG - Intergenic
1100756793 12:97760004-97760026 TACATTATGGTGCCACTGAAAGG + Intergenic
1103228960 12:119311819-119311841 GACTTTACTGTGCCTCTCAGGGG + Intergenic
1103836096 12:123822240-123822262 GTCATTTGGGTGCCTCTCATTGG + Intronic
1109991748 13:70067770-70067792 GAAAAGATGGTGGCTCTCACTGG - Intronic
1110366764 13:74695546-74695568 GGCAGTATGGTGCCTCTACCTGG - Intergenic
1111741810 13:92214665-92214687 GTCATTATTCTGCCTCTCAGGGG - Intronic
1118352436 14:64982813-64982835 GTCCTTGTGGTGCCTCACACTGG - Intronic
1118694425 14:68370627-68370649 GAGATTATGGTGGCTCAGACTGG + Intronic
1121722104 14:96116489-96116511 GACCTTATAGCGACTCTCACTGG + Intergenic
1133838053 16:9383967-9383989 GAATTTATTGTGCCTCTCTCAGG - Intergenic
1137553303 16:49454996-49455018 GACATCATGGTGCCTGAAACAGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1144794316 17:17880837-17880859 GACATTACAGTTCCTCTCTCTGG - Intronic
1146111706 17:30095538-30095560 GCCATCATGGTGGCTCTCATAGG + Intronic
1155273018 18:24158986-24159008 GAGATAATGGTGCCTCTGAAGGG + Intronic
1168050943 19:53829432-53829454 GACAAAATGGTGTCTCTAACTGG + Intergenic
1168578641 19:57535021-57535043 GTCCTTATGGTGTCTCCCACTGG - Intronic
928138397 2:28706276-28706298 GCCATTATCGTGCCTGTCATAGG - Intergenic
930722179 2:54648298-54648320 GACATGTTGGTGCCTATCCCTGG - Intronic
932046463 2:68355548-68355570 TTCATTATTGTGCCTTTCACAGG - Intergenic
934517017 2:94994626-94994648 GACATTATGTCCCCTCTCCCCGG + Intergenic
939533426 2:143393772-143393794 GACATTAAGGTGTCTTTCACAGG + Intronic
940987663 2:160064383-160064405 GACATTGGGCTACCTCTCACTGG + Intergenic
941432733 2:165431282-165431304 GACCTCATGGTGCCTCTGAAAGG + Intergenic
1176306563 21:5126615-5126637 GACATTATGGGGGCTCACGCTGG + Intronic
1179298008 21:40080504-40080526 TACATCATGGTGCTTCTCCCAGG - Intronic
1179850496 21:44135415-44135437 GACATTATGGGGGCTCACGCTGG - Intronic
1184388312 22:44188663-44188685 GAAATTATGAGGCCTCTCAGAGG - Intronic
950585153 3:13887047-13887069 GACACCATGGTGCCAGTCACAGG - Intergenic
951806914 3:26655372-26655394 GACATTATGGTGCCTCTCACAGG - Intronic
951832798 3:26949290-26949312 GACATTATTTTGCCTACCACAGG - Intergenic
951999479 3:28769482-28769504 GACCTTATTGTGCAACTCACTGG + Intergenic
955750176 3:62178990-62179012 GACATTGGTGTGCCTCTCATTGG + Intronic
957144298 3:76403145-76403167 GCCATTATTATGCCTATCACAGG + Intronic
957977812 3:87469948-87469970 TACACTATGGTGCCTCTTTCTGG + Intergenic
962745938 3:138397185-138397207 GAGCTTATGCAGCCTCTCACGGG + Intronic
963009461 3:140755597-140755619 CTCATTATGATGCCTATCACTGG - Intergenic
965636535 3:170787973-170787995 GGCATTATGCTGCCTACCACAGG - Intronic
969704484 4:8784433-8784455 GGCATGATGGTGCCTCCCAGGGG + Intergenic
970406033 4:15765366-15765388 GAGATGATGGTGCCTTGCACTGG - Intergenic
970932917 4:21534566-21534588 TACATTATGGTGCCTTTCTAAGG + Intronic
972610783 4:40653602-40653624 GATATTTTGGTGTCTCTCTCTGG - Intergenic
978447331 4:108791959-108791981 GACATTAGGTTGCCTTTCCCTGG + Intergenic
980832770 4:138151872-138151894 GCCATTATTGTGTCTATCACAGG - Intergenic
983961214 4:173757241-173757263 AACATTACAGTGCCTCTCAGAGG + Intergenic
990916857 5:60915901-60915923 GACATGATGCTGCCTACCACAGG + Intronic
991439819 5:66635148-66635170 AGCATTATGTTGCCTATCACAGG + Intronic
994452084 5:99955803-99955825 GAAATTATGGTGCTTTTCCCAGG - Intergenic
995086215 5:108112912-108112934 GACATTATGTCACATCTCACTGG + Intronic
1002086618 5:176779956-176779978 GGCATTATTCTGCCTGTCACAGG - Intergenic
1003726291 6:8768893-8768915 GACATAATGGTTCCTGTCACAGG - Intergenic
1004566803 6:16805548-16805570 CACATCATGCTGCCTCTCTCTGG + Intergenic
1005445350 6:25916885-25916907 GCCAAGATGGTGCCTCTCAGAGG + Intronic
1009746108 6:67818264-67818286 TACACTATGCTGCCTCTCAAGGG - Intergenic
1014057174 6:117029641-117029663 TACATTCTGGTCCCTCTCAAGGG - Intergenic
1014209197 6:118690450-118690472 GACATTATGGTCCCTTCCACAGG + Intronic
1019648029 7:2141415-2141437 AACATGATGGTGCCTCAGACAGG + Intronic
1020817122 7:12919355-12919377 TAAATTATGATGCCTCTCATCGG - Intergenic
1020869006 7:13604418-13604440 GACATGATGGTGACTCACATAGG + Intergenic
1030300354 7:107968377-107968399 GCCATTATTCTGCCTCACACAGG - Intronic
1030334573 7:108310793-108310815 GACATTTTAGTGGCTCTCATAGG + Intronic
1030921007 7:115387315-115387337 CTCATTATGGTGCCTGTGACAGG + Intergenic
1031549930 7:123097148-123097170 GATATTTTGGTCTCTCTCACTGG - Intergenic
1035133256 7:156675315-156675337 GAGACGAGGGTGCCTCTCACAGG + Intronic
1035156867 7:156921359-156921381 GTCACTCTGGTTCCTCTCACTGG - Intergenic
1036967072 8:13311754-13311776 GATATTTTGGTGCTGCTCACAGG + Intronic
1038572526 8:28675153-28675175 GACTGTTTGGTGCCTCTCCCAGG - Intronic
1041029459 8:53721707-53721729 TACATTATTCTACCTCTCACTGG + Intronic
1045269910 8:100652809-100652831 GACATTATGATCCATCTCACTGG - Intronic
1047343097 8:124001593-124001615 GATATTATTATGCCTCTCTCAGG + Intronic
1048124972 8:131624287-131624309 GACCTTAAGATGCCCCTCACTGG - Intergenic
1048448017 8:134507063-134507085 GACATCAAGGTCCCTCCCACAGG + Intronic
1052660053 9:31417545-31417567 GACATTATGGTTTCCCTCAGTGG - Intergenic
1055828815 9:80357634-80357656 GCCATGATGCTGCCACTCACTGG + Intergenic
1056430825 9:86526440-86526462 GCCATTATGCTGCCTCCCAAAGG + Intergenic
1057836383 9:98448734-98448756 GAGATTGTGGTGCCTATGACAGG - Intronic
1058671082 9:107360874-107360896 GCCATGATTCTGCCTCTCACAGG + Intergenic
1061538914 9:131266809-131266831 GACATTATGGTGCCTGAAGCTGG - Intronic
1186257685 X:7740409-7740431 AACATCATGGTGCCGCTCACAGG + Intergenic
1188340380 X:28993389-28993411 GACATGATGGTGGCTGGCACTGG + Intronic
1188355237 X:29182697-29182719 GCCATTATTGTGCCTACCACAGG - Intronic
1188961718 X:36501078-36501100 GACATTTTGGTCTCTCTCAGTGG + Intergenic
1189580815 X:42404346-42404368 GACAATATGGTGCCAGTCAAGGG - Intergenic
1192388374 X:70697327-70697349 GACATTATTCTGCTTGTCACTGG + Intronic
1195603454 X:106774672-106774694 GAAATTATGGTGGCTTTGACTGG - Intronic
1201682500 Y:16663232-16663254 GACATTATCCTGACTATCACAGG + Intergenic