ID: 951807619

View in Genome Browser
Species Human (GRCh38)
Location 3:26663888-26663910
Sequence TTCTACTATAGCCTTTGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951807612_951807619 30 Left 951807612 3:26663835-26663857 CCTGGGTTCCATATTCTCCTCCA 0: 1
1: 0
2: 0
3: 26
4: 323
Right 951807619 3:26663888-26663910 TTCTACTATAGCCTTTGAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 101
951807618_951807619 -6 Left 951807618 3:26663871-26663893 CCATGTCTTGCTTGGATTTCTAC 0: 1
1: 0
2: 1
3: 19
4: 270
Right 951807619 3:26663888-26663910 TTCTACTATAGCCTTTGAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 101
951807615_951807619 10 Left 951807615 3:26663855-26663877 CCAGTTCAGAACCTTGCCATGTC 0: 1
1: 0
2: 1
3: 11
4: 112
Right 951807619 3:26663888-26663910 TTCTACTATAGCCTTTGAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 101
951807613_951807619 22 Left 951807613 3:26663843-26663865 CCATATTCTCCTCCAGTTCAGAA 0: 1
1: 0
2: 0
3: 20
4: 237
Right 951807619 3:26663888-26663910 TTCTACTATAGCCTTTGAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 101
951807614_951807619 13 Left 951807614 3:26663852-26663874 CCTCCAGTTCAGAACCTTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 130
Right 951807619 3:26663888-26663910 TTCTACTATAGCCTTTGAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 101
951807617_951807619 -1 Left 951807617 3:26663866-26663888 CCTTGCCATGTCTTGCTTGGATT 0: 1
1: 0
2: 4
3: 31
4: 209
Right 951807619 3:26663888-26663910 TTCTACTATAGCCTTTGAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951807619 Original CRISPR TTCTACTATAGCCTTTGAGT TGG Intronic
906831798 1:49040280-49040302 TTTTATTATAGCCTTTTAGTGGG - Intronic
907123177 1:52025574-52025596 TTTTACTGTTTCCTTTGAGTAGG + Intronic
909182814 1:72446966-72446988 TACTACTGTAGCCTTTTATTTGG + Intergenic
918768745 1:188524099-188524121 TTATGCAATAGCATTTGAGTTGG + Intergenic
920208585 1:204311929-204311951 TCCTACTATAGGCATTAAGTTGG + Intronic
1064157418 10:12915685-12915707 TGCTACTGGAGCCTTTGGGTAGG + Intronic
1070197057 10:74167657-74167679 TTCTAAGCTAGCCTTTGAGAGGG - Intronic
1071680315 10:87698332-87698354 TTCTACTATAGCTTTTTTTTTGG + Intronic
1071810938 10:89180021-89180043 CTCTACTGTAACCCTTGAGTAGG + Intergenic
1074414054 10:113251618-113251640 TTCTATTATAGCCTTAGTTTAGG - Intergenic
1077677864 11:4213488-4213510 TTCTGCAATTGCCTTTGAGAAGG - Intergenic
1079636735 11:22751617-22751639 TTCTACTGTAGCTTTTTAGAGGG + Intronic
1080316486 11:30955871-30955893 TTCAAGTATAGGCTTTGAGTTGG - Intronic
1080494223 11:32799828-32799850 TTTTACTATAGCATTTAAGTAGG - Intergenic
1083591686 11:63899122-63899144 TTCTCCTTGTGCCTTTGAGTGGG + Intronic
1088064473 11:105699305-105699327 TTCAAATATAACCTGTGAGTGGG + Intronic
1092324112 12:7510850-7510872 TTCTACTATATCTTTTCAATCGG - Intergenic
1093357588 12:18187531-18187553 TTCTGCTATAACTTTTGAGATGG + Intronic
1094645106 12:32315832-32315854 TTATAAAATAGGCTTTGAGTGGG + Intronic
1096202178 12:49692431-49692453 TTATTCTATAAGCTTTGAGTTGG - Intronic
1099030943 12:77524735-77524757 TTCTAATAGGGTCTTTGAGTGGG - Intergenic
1100499509 12:95160335-95160357 TTTTATTATAGCCATTGTGTGGG - Intronic
1103802344 12:123547004-123547026 GCCTACTGTAGCCTTTCAGTAGG - Intergenic
1109390960 13:61692275-61692297 TTTTAATATATCCTTTGAATTGG + Intergenic
1111613206 13:90631956-90631978 TTCTAATATATCCTTGGAGTGGG + Intergenic
1120218477 14:81705718-81705740 TTCTCCCCTAGCGTTTGAGTTGG + Intergenic
1120789425 14:88565439-88565461 TTTTAATATCGCCATTGAGTTGG - Intronic
1120948603 14:90020661-90020683 TTCAACTATAGCCAGTGAGGAGG - Intronic
1124195297 15:27620361-27620383 TTCTACTATAGCATTAAAATGGG - Intergenic
1124642292 15:31403247-31403269 TTTCACTGTAGCCTTTGACTTGG - Intronic
1128589795 15:68885599-68885621 TTCTACTATTGCCTTTGAAAAGG - Intronic
1132174085 15:99694669-99694691 TCATACTGTAGCCTTTGGGTAGG + Intronic
1133605727 16:7385862-7385884 TTCTGCTTCAGCCTCTGAGTAGG + Intronic
1134425797 16:14142992-14143014 TTCACATATAGACTTTGAGTAGG - Intronic
1137631399 16:49948400-49948422 TTTGATTTTAGCCTTTGAGTGGG - Intergenic
1140151391 16:72370821-72370843 ATCATCTATAGCCATTGAGTGGG - Intergenic
1140822542 16:78676525-78676547 TTAGACTGTAGACTTTGAGTTGG - Intronic
1144293140 17:13845738-13845760 TTCCACTAGGGTCTTTGAGTTGG + Intergenic
1150169214 17:62974588-62974610 TACTACTATTGTCTTTGACTTGG + Intergenic
1151494932 17:74453616-74453638 TTCTGCTCCAGACTTTGAGTCGG - Intergenic
1153918094 18:9763926-9763948 TTCTACTAAAGGCCTGGAGTTGG + Intronic
1162413616 19:10520819-10520841 TTCAACAACAGCCTTGGAGTGGG - Intergenic
925089946 2:1147060-1147082 TTATATAATAGCATTTGAGTTGG + Intronic
926079109 2:9969558-9969580 TTATATTATAACGTTTGAGTTGG + Intronic
927726090 2:25424477-25424499 TTGTACCATTGCCTTTCAGTTGG - Intronic
929316171 2:40481858-40481880 TTCTTCTATACCCTTTTAGTTGG + Intronic
933322552 2:80795305-80795327 TCCTACTACTGCCTTTGATTTGG - Intergenic
933470563 2:82717584-82717606 TTCTAATCTAGGCTTTGATTTGG + Intergenic
937664046 2:124463973-124463995 TTTTTCTCTAACCTTTGAGTTGG - Intronic
940614770 2:156036581-156036603 TTCTGCAATAGCTCTTGAGTGGG + Intergenic
941936310 2:170983809-170983831 CTCTACCATAGACTTTGACTTGG - Intergenic
945054406 2:205855660-205855682 TTCTACTTTACCCTTTCATTGGG + Intergenic
1171538230 20:25917766-25917788 TTCTATTATTATCTTTGAGTGGG - Intergenic
1173039815 20:39451789-39451811 TTCTACTTGAGTCTTTGGGTTGG - Intergenic
951196505 3:19829021-19829043 TTTTACTATAACCCTTGACTTGG + Intergenic
951569105 3:24043568-24043590 TTCTCCTATTGACTTTGGGTGGG - Intergenic
951659381 3:25045568-25045590 TTCTACTACAGTGTGTGAGTTGG + Intergenic
951807619 3:26663888-26663910 TTCTACTATAGCCTTTGAGTTGG + Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
956494270 3:69807467-69807489 TTCCACAATTGCCTTTGAGAAGG - Intronic
958030484 3:88103225-88103247 TTCCACTATAGCCTTTATATCGG - Intronic
959057312 3:101580918-101580940 TCCTAAAATTGCCTTTGAGTTGG + Intronic
962779123 3:138694616-138694638 TTCTAGTATAAACATTGAGTTGG + Intronic
963620710 3:147601957-147601979 TTCTACTATAGCCTTAAAAGAGG - Intergenic
964438442 3:156677342-156677364 TTCTACTATAAGGTTAGAGTGGG - Intronic
979645694 4:123065297-123065319 TTCTCCAATAGGCTTTGCGTTGG + Intronic
979877606 4:125912947-125912969 TACTACTCTAGGCATTGAGTGGG - Intergenic
980146959 4:128998305-128998327 TTGTATTATAGGTTTTGAGTAGG - Intronic
983776577 4:171615500-171615522 TTCTACTTCAGCCTTTGCCTAGG - Intergenic
987413871 5:17642696-17642718 TTCTACCTCAGCCTCTGAGTAGG + Intergenic
990343089 5:54844274-54844296 TTTTATTATAGCCTTTCTGTGGG - Intergenic
993087512 5:83381816-83381838 TTGTAACATAGCCTTTGATTTGG + Intergenic
993551208 5:89276176-89276198 ATCTAATCTAGCCTTGGAGTAGG + Intergenic
994400868 5:99276941-99276963 TTCTAGTATTGCTTTTAAGTAGG - Intergenic
999469964 5:151845538-151845560 TTTAACTATAGCCATTTAGTGGG - Intronic
1004013530 6:11711623-11711645 TTTTAATAAAGCATTTGAGTAGG - Intergenic
1004566196 6:16800018-16800040 TTCTCCTAGAGGCTTTTAGTTGG + Intergenic
1005716663 6:28555841-28555863 TTCTACCACAGCCTCTAAGTAGG + Intergenic
1007247269 6:40471596-40471618 TTCTAATATAGTATTGGAGTTGG - Intronic
1008225306 6:48907364-48907386 GGCTACTATAGCCTTGTAGTAGG + Intergenic
1010196931 6:73248916-73248938 TTCTAGTATGGCCTTTATGTTGG + Intronic
1014005369 6:116411815-116411837 TTCTACTATAACCTGTAACTTGG + Intronic
1017350479 6:153435300-153435322 TTCTCCTATAGACTCTGAATTGG - Intergenic
1020489146 7:8757658-8757680 TTCTGCTACAGGCTTTGAATTGG + Intergenic
1024862264 7:53858389-53858411 TTCTGCTAGAGCAATTGAGTAGG - Intergenic
1026244366 7:68605633-68605655 CTCTTCTACAGGCTTTGAGTGGG - Intergenic
1041590964 8:59583204-59583226 ATCTATTCTAGTCTTTGAGTGGG - Intergenic
1041658825 8:60380821-60380843 TTTAACTACAGCCTATGAGTTGG - Intergenic
1043498875 8:80833532-80833554 TTCTATTATAGCCATTCATTAGG - Intronic
1044976705 8:97672210-97672232 TTTTACTATAGCAGTGGAGTTGG + Intronic
1045635529 8:104183282-104183304 TTCAACTATAGCAATTAAGTAGG + Intronic
1047162504 8:122396424-122396446 TTGTACAATATCCTTTGTGTAGG - Intergenic
1048498860 8:134957977-134957999 CTCTCCTATAGCCCTTGAGTGGG - Intergenic
1050538463 9:6649962-6649984 TTCCATTATAGCCTTTGTTTGGG - Intergenic
1052214854 9:25953364-25953386 TTTTACTATATTCTATGAGTTGG - Intergenic
1053109027 9:35440814-35440836 TTCTACTATAGCCTTTGGTCAGG + Intergenic
1053175781 9:35922716-35922738 TTCTACTCTCGCTTTTGATTTGG + Intergenic
1055806584 9:80102047-80102069 TTTTACTATAGCCATCTAGTGGG + Intergenic
1058465747 9:105225491-105225513 TGCTACTATATCCCTTGACTAGG + Intergenic
1186113931 X:6285116-6285138 TTCTGCTATAGAGTCTGAGTTGG - Intergenic
1187408082 X:19022343-19022365 TTCTACTTTAGCCTTGGTTTAGG + Intronic
1187956588 X:24524716-24524738 TTCTGCTGTAGTCTTTGGGTTGG - Intronic
1188406503 X:29817180-29817202 TTGTACAATAGCTTTTGACTTGG + Intronic
1189070053 X:37853918-37853940 ATCTATTATAGCATTTAAGTTGG - Intronic
1190000284 X:46679543-46679565 GTCAACTATAGTCTCTGAGTGGG + Intronic
1195352830 X:104010866-104010888 ATCTGCTATAGCATTTCAGTGGG - Intergenic
1196078692 X:111607085-111607107 CTCTCCTAGAGCCTTTGAGGGGG - Intergenic
1198037026 X:132810929-132810951 TTATTTTATAGCCTATGAGTTGG - Intronic
1198935813 X:141902372-141902394 TTGTAAAATAGCCTTTGATTGGG + Intergenic
1199563068 X:149184861-149184883 TTCCAATATAACCTTAGAGTGGG + Intergenic