ID: 951810439

View in Genome Browser
Species Human (GRCh38)
Location 3:26693038-26693060
Sequence GATCAAGAGCAGGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1097
Summary {0: 1, 1: 0, 2: 11, 3: 145, 4: 940}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951810431_951810439 15 Left 951810431 3:26693000-26693022 CCAGGGCTTGTTCACATGATGGC 0: 2
1: 5
2: 12
3: 55
4: 264
Right 951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG 0: 1
1: 0
2: 11
3: 145
4: 940
951810429_951810439 27 Left 951810429 3:26692988-26693010 CCAGCAGGCTAGCCAGGGCTTGT 0: 1
1: 12
2: 42
3: 141
4: 390
Right 951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG 0: 1
1: 0
2: 11
3: 145
4: 940

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951810439 Original CRISPR GATCAAGAGCAGGCCGGGCG CGG Intronic
900143417 1:1147758-1147780 GAAAAAGCACAGGCCGGGCGCGG + Intergenic
900244121 1:1629863-1629885 GATCTGGAGCAGGCGGGGCTGGG - Intronic
900360463 1:2286160-2286182 GATGAACAGTAGGCTGGGCGTGG - Intronic
900579039 1:3399235-3399257 GGTCAAGAGGAGGCAGTGCGTGG + Intronic
901011594 1:6205739-6205761 CTTCAAGGGTAGGCCGGGCGCGG - Intronic
901076272 1:6556690-6556712 AAAGAAAAGCAGGCCGGGCGCGG - Intronic
901093043 1:6655811-6655833 AAACAAGAACAGGCCGGGTGTGG + Intronic
901103182 1:6735349-6735371 GAAAAAAAACAGGCCGGGCGCGG + Intergenic
901256630 1:7834208-7834230 AACCTAGAGCAGGCTGGGCGTGG - Intronic
901364717 1:8736495-8736517 GAACAAGTATAGGCCGGGCGCGG - Intronic
901462766 1:9401281-9401303 AAACAAAAGGAGGCCGGGCGCGG + Intergenic
901554022 1:10017483-10017505 TATCTTGAGCAGGCCGGTCGCGG - Intergenic
901669359 1:10846423-10846445 CAAAAAGAGCAGGCCAGGCGCGG - Intergenic
901704933 1:11066469-11066491 AATCCAGAGCCGGCCGGGTGCGG - Intergenic
901728825 1:11263178-11263200 AATCAATAGCTGGCCCGGCGCGG + Intergenic
901848472 1:11999802-11999824 AATAAAGGGTAGGCCGGGCGCGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902423108 1:16297569-16297591 AGTCAAGTCCAGGCCGGGCGTGG + Intronic
902800469 1:18826457-18826479 GGTGAAGAGCAGGCCAGGAGTGG + Intergenic
903080570 1:20808389-20808411 AATGAAGAGGTGGCCGGGCGCGG + Intronic
903150114 1:21401538-21401560 GGTTGAGACCAGGCCGGGCGTGG + Intergenic
903565238 1:24260220-24260242 GTTCTAGAGCTGGCCGGGCGCGG + Intergenic
904173453 1:28608461-28608483 GAAAGAGAGCAGGCCGGGTGTGG + Intronic
904219244 1:28951561-28951583 AATCGAGATCAGGCTGGGCGTGG + Intronic
904242648 1:29158829-29158851 AAACAAAATCAGGCCGGGCGCGG + Intronic
904446488 1:30577005-30577027 GATCATGAGCAGGCAGGTGGGGG - Intergenic
904754861 1:32762876-32762898 GTTCAAGACCGGGCCGGGCGTGG - Intronic
905078652 1:35297138-35297160 AAGTAAGAGCAGGCTGGGCGCGG - Intronic
905170288 1:36105980-36106002 GATAAGGAGGAGGCAGGGCGCGG + Intronic
905332944 1:37220266-37220288 AATAAAGAGGAGGCCGGGCATGG + Intergenic
905913437 1:41669340-41669362 GATCAATAGCAGTCTGGGGGTGG + Intronic
905937655 1:41837614-41837636 ACAAAAGAGCAGGCCGGGCGTGG - Intronic
906000130 1:42417665-42417687 GAAAAAGGCCAGGCCGGGCGTGG + Exonic
906139506 1:43525510-43525532 GAGCAACATCAGGCCAGGCGTGG + Intronic
906281434 1:44556847-44556869 GAACAGGAAGAGGCCGGGCGCGG - Intronic
906362609 1:45176553-45176575 AATGTAGACCAGGCCGGGCGCGG - Intronic
906915264 1:50002657-50002679 GAACTAGGGCTGGCCGGGCGCGG - Intronic
907352566 1:53844871-53844893 AATCAAGAACTGGCCGGGTGCGG - Intergenic
907508063 1:54936436-54936458 GATAAAGAGGAGGCTGGGTGCGG - Intergenic
908399310 1:63755547-63755569 AAGGAAGAGCAGGCTGGGCGCGG + Intergenic
908837615 1:68243834-68243856 TATAAAGAGTTGGCCGGGCGTGG + Intergenic
909087797 1:71187983-71188005 GTTGAAAAGCCGGCCGGGCGCGG - Intergenic
909224847 1:73006174-73006196 GAAAAAGAGCAGGCCAGGCGTGG - Intergenic
909911318 1:81261013-81261035 TATCAGGTGCCGGCCGGGCGCGG - Intergenic
910015543 1:82519027-82519049 GAACAGGCGCAGGCCGGGCGTGG + Intergenic
910290512 1:85596066-85596088 GATGGAGAACAGGCTGGGCGTGG + Intergenic
912076114 1:105878468-105878490 TAGTCAGAGCAGGCCGGGCGTGG + Intergenic
912171765 1:107108751-107108773 GATAATAAGCAGGCCGGGCATGG - Intergenic
912362379 1:109105592-109105614 AGTCAAGTGGAGGCCGGGCGTGG + Intergenic
912685533 1:111759682-111759704 AATGAAGAGCAGGCCGGGCGCGG + Intronic
913119047 1:115722755-115722777 AAGCATAAGCAGGCCGGGCGTGG + Intronic
913468116 1:119163935-119163957 GATTGAGACCATGCCGGGCGTGG - Intergenic
914424236 1:147560297-147560319 GAATAAGGCCAGGCCGGGCGCGG + Intronic
914475084 1:148015602-148015624 AATAGAGAGAAGGCCGGGCGCGG - Intergenic
914706635 1:150175519-150175541 TAACATCAGCAGGCCGGGCGCGG - Intergenic
914887235 1:151595468-151595490 AAACATGAGCAGGCCGGGCGCGG - Intergenic
915347343 1:155204297-155204319 ACTCGAGACCAGGCCGGGCGCGG + Intronic
915466979 1:156103778-156103800 GATAAAGAGCAGGGAGGGTGGGG - Intronic
915496953 1:156288626-156288648 TAACAAGAGCAGGCCAGGTGTGG - Intronic
915502019 1:156325871-156325893 GATCAAGAGAAGGCCAGGCGTGG - Intronic
915515758 1:156411582-156411604 GGTCAAGACTAGGCCCGGCGCGG + Intronic
915632495 1:157163245-157163267 GAAAAAGAGCAGGCCGGAAGCGG - Intergenic
916102010 1:161400690-161400712 AATTAAGAAGAGGCCGGGCGCGG + Intergenic
916187468 1:162147037-162147059 GATAAATACAAGGCCGGGCGCGG + Intronic
916943533 1:169700943-169700965 AATTAAGAGCAGGCCAGGCGTGG + Intronic
917986379 1:180324167-180324189 GACATAGAGTAGGCCGGGCGCGG - Intronic
918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG + Intronic
918791319 1:188834203-188834225 GGGCTAGAGGAGGCCGGGCGCGG + Intergenic
919034865 1:192293489-192293511 AAAAAAAAGCAGGCCGGGCGCGG - Intergenic
919431411 1:197496882-197496904 GACTAATTGCAGGCCGGGCGCGG + Intergenic
919551602 1:198996360-198996382 AAAGACGAGCAGGCCGGGCGCGG - Intergenic
919676391 1:200387782-200387804 CAGCAAGAACTGGCCGGGCGTGG + Intergenic
919905910 1:202078228-202078250 AAACAGCAGCAGGCCGGGCGCGG - Intergenic
920132995 1:203747053-203747075 GATGGAGGGCAGGCTGGGCGTGG - Intergenic
920389165 1:205588179-205588201 GATCATGAAAAGGCCAGGCGCGG + Intronic
920400247 1:205671566-205671588 GAACAACAGCAGGCCGGGCACGG + Intronic
921015825 1:211189841-211189863 AAGTAAGAGTAGGCCGGGCGCGG - Intergenic
921311257 1:213846000-213846022 AAAAAAGGGCAGGCCGGGCGGGG + Intergenic
921715708 1:218415402-218415424 GCAGATGAGCAGGCCGGGCGCGG + Intronic
921899994 1:220439822-220439844 AATCAAGAGCAGGCTGAGCATGG - Intergenic
922092629 1:222411224-222411246 GATCAAGGGCAGGGAGGGAGAGG + Intergenic
922141124 1:222887786-222887808 AAACAAAAACAGGCCGGGCGCGG - Intronic
922284905 1:224162442-224162464 GATCAAGAAAAGGCTGGGCTAGG + Intergenic
922474116 1:225895092-225895114 AATCAAGAACGGGCTGGGCGCGG + Intronic
922652078 1:227349233-227349255 GACAAACTGCAGGCCGGGCGCGG - Intergenic
922923766 1:229330550-229330572 AAGAAAGTGCAGGCCGGGCGCGG + Intronic
923154674 1:231268010-231268032 GAGAAAGGACAGGCCGGGCGCGG + Intronic
923726114 1:236506870-236506892 AGGCAGGAGCAGGCCGGGCGTGG + Intergenic
924309755 1:242728047-242728069 GATGAAGTTCTGGCCGGGCGCGG + Intergenic
924473201 1:244361517-244361539 AATGTAGAACAGGCCGGGCGCGG - Intronic
924473554 1:244364393-244364415 AATAAAAAGCAGGCCGGGTGTGG - Intronic
924482004 1:244444223-244444245 GATGAAATACAGGCCGGGCGCGG + Intronic
924520952 1:244805664-244805686 GTTAAAAAACAGGCCGGGCGAGG - Intergenic
924769626 1:247067550-247067572 GCTCCAGCACAGGCCGGGCGCGG + Intronic
924788957 1:247226232-247226254 AATCAATATCTGGCCGGGCGCGG - Intergenic
924929771 1:248719734-248719756 AGGCAAGAGAAGGCCGGGCGCGG + Intronic
1063253254 10:4297284-4297306 GATCAAAAGCAGGCTGGGTGTGG - Intergenic
1063326048 10:5103176-5103198 GATGAAGAGGAGGCCAGGAGCGG - Intronic
1063387829 10:5627305-5627327 AAACAACAACAGGCCGGGCGCGG - Intergenic
1064142543 10:12802808-12802830 AATGAAGAGCAGGCCGGGGGCGG - Intronic
1065476431 10:26143038-26143060 GAGCAAGGTCAGGCCGGGCGCGG + Intronic
1065547682 10:26838310-26838332 GATTAAGAGTTGGCCGGGTGCGG - Intronic
1065706353 10:28474771-28474793 ATTCATGTGCAGGCCGGGCGCGG + Intergenic
1066076902 10:31887945-31887967 TAGGAAGGGCAGGCCGGGCGCGG - Intronic
1066368948 10:34803498-34803520 GTTCAGGAGTTGGCCGGGCGCGG + Intronic
1067677980 10:48403167-48403189 AATTCAGAGCAAGCCGGGCGCGG + Intronic
1068120243 10:52777131-52777153 GATAAAGAGCAGGCTGAGAGGGG + Intergenic
1068382389 10:56273796-56273818 AATTAAGCTCAGGCCGGGCGCGG + Intergenic
1068710464 10:60127985-60128007 TATGAAGAACTGGCCGGGCGCGG - Intronic
1068845346 10:61665595-61665617 TATCTAGGGAAGGCCGGGCGCGG + Intronic
1069037581 10:63661527-63661549 CATCAAGAAGAGGCCGGGCGTGG + Intergenic
1069440701 10:68425689-68425711 GTTCCAGAGATGGCCGGGCGCGG - Intronic
1069446502 10:68477605-68477627 GATCAAGACCAGGCCAGGCACGG - Intergenic
1069488464 10:68841233-68841255 AATCAAAAACAGGCCGGGCATGG - Intronic
1069526434 10:69176138-69176160 TAGCAAAAGCAGGCCGGGCGCGG + Intergenic
1069539565 10:69283488-69283510 AATAAAGAGCTGGCTGGGCGTGG + Intronic
1069923604 10:71832738-71832760 TATCAAGAGAGGGCCGGGCCGGG + Intronic
1070389930 10:75960903-75960925 GATTAAAACCAGGCCGGGTGTGG - Intronic
1070796074 10:79217131-79217153 CATAAAGTGCAGGCCGGGCGCGG + Intronic
1071309025 10:84326225-84326247 GAGGAAGGGCAGGCCGGGCACGG + Intergenic
1071577960 10:86743707-86743729 GTTATAGAGCAGGCCGGGCGAGG - Intergenic
1072431036 10:95370531-95370553 GTACAAAAGGAGGCCGGGCGCGG - Intronic
1072658749 10:97349101-97349123 GTGCAAGAAGAGGCCGGGCGCGG + Intergenic
1072713377 10:97733059-97733081 TATAAAAATCAGGCCGGGCGCGG - Intergenic
1072819727 10:98544418-98544440 GAACTAGAGAAGGCCGGGCGCGG + Intronic
1073343500 10:102764102-102764124 AATACAGAGAAGGCCGGGCGTGG - Intronic
1074410029 10:113220332-113220354 AACCAAGAGCTGGCCGAGCGCGG - Intergenic
1074857692 10:117485542-117485564 GAAGTGGAGCAGGCCGGGCGTGG + Intergenic
1074859195 10:117497405-117497427 GAGTAAGACTAGGCCGGGCGTGG - Intergenic
1075037002 10:119077841-119077863 AATTCAGAGGAGGCCGGGCGTGG - Intronic
1075092097 10:119449508-119449530 TATAAAGAGTAGGCCGGGCACGG + Intronic
1075381305 10:122020939-122020961 GATCATTAATAGGCCGGGCGCGG + Intronic
1075511634 10:123077270-123077292 AAACAAGAACAGGCTGGGCGAGG - Intergenic
1075882692 10:125867444-125867466 AATCAAGGACAGGCCGGGTGTGG + Intronic
1076598811 10:131643923-131643945 GTTTAAAAACAGGCCGGGCGCGG - Intergenic
1076659945 10:132048928-132048950 AGTCAAGCCCAGGCCGGGCGCGG - Intergenic
1076745851 10:132513213-132513235 TATTAAGAATAGGCCGGGCGTGG + Intergenic
1077071970 11:679020-679042 TATAAAAATCAGGCCGGGCGCGG + Intronic
1077501025 11:2909768-2909790 GGCCAAGAGGAGGCGGGGCGGGG - Intronic
1077637346 11:3852430-3852452 GATTAACATGAGGCCGGGCGCGG - Intergenic
1077760838 11:5095416-5095438 GAATATGAGCAGGCTGGGCGTGG - Intergenic
1078195611 11:9134401-9134423 GAGCAAGAGTAGGCAGGGAGAGG - Intronic
1078449392 11:11429053-11429075 GATAAAGAGCAGGCAGTGAGGGG - Intronic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1079222856 11:18579155-18579177 TATTAACTGCAGGCCGGGCGTGG - Intronic
1079371600 11:19858144-19858166 GAACAAGTTCTGGCCGGGCGTGG - Intronic
1080139479 11:28898774-28898796 AAGCAAGAAAAGGCCGGGCGTGG + Intergenic
1080197837 11:29632524-29632546 GACAAAGAGCTGGCCGGGAGTGG + Intergenic
1080579984 11:33634331-33634353 CAGTAAGCGCAGGCCGGGCGTGG - Intronic
1080681110 11:34477031-34477053 GATCAAGAGGAAACTGGGCGTGG + Intergenic
1080848160 11:36044535-36044557 GAGCAAGAAAAGACCGGGCGTGG - Intronic
1081095578 11:38930100-38930122 CATAAGTAGCAGGCCGGGCGAGG + Intergenic
1081182189 11:39997516-39997538 GGTGAAGTTCAGGCCGGGCGCGG + Intergenic
1081246875 11:40777976-40777998 AATCAAGATCTGGCCGGGAGCGG - Intronic
1081627590 11:44664669-44664691 CATCATGATTAGGCCGGGCGCGG + Intergenic
1081846017 11:46240996-46241018 AACCATAAGCAGGCCGGGCGTGG - Intergenic
1081884297 11:46481651-46481673 GAACAAAAATAGGCCGGGCGCGG - Intronic
1081903209 11:46647566-46647588 GAACAATAGCAGGCTGGGCATGG - Intronic
1083087654 11:60167536-60167558 AATCAAGAACAGCCTGGGCGTGG + Intergenic
1083338347 11:61941460-61941482 TATAAAGACCAGGCTGGGCGTGG + Intergenic
1083403888 11:62443560-62443582 GAGCAAGACCCAGCCGGGCGCGG - Intronic
1083552555 11:63600892-63600914 GTAGAAGAGTAGGCCGGGCGTGG - Intronic
1084109507 11:67004511-67004533 GAGGAAGAGGCGGCCGGGCGCGG + Intergenic
1084128439 11:67116646-67116668 GCTTTAGAACAGGCCGGGCGCGG - Intergenic
1084134350 11:67164886-67164908 GTACAATAGCAGGCCAGGCGCGG - Intronic
1084161163 11:67351126-67351148 GATCCAAAGCAGGGCTGGCGAGG - Intronic
1084528791 11:69714457-69714479 AAACAAGTGCAGGCCAGGCGCGG + Intergenic
1084662331 11:70553381-70553403 GATTAAGATCAGGCCGGGCACGG - Intronic
1085193106 11:74646261-74646283 AATGAAAATCAGGCCGGGCGCGG - Intronic
1085226307 11:74924183-74924205 GAGTAAGAGTGGGCCGGGCGCGG + Intronic
1085985953 11:81788590-81788612 AATAGACAGCAGGCCGGGCGCGG - Intergenic
1086014809 11:82154602-82154624 AATCAACAATAGGCCGGGCGCGG - Intergenic
1086373572 11:86178279-86178301 GATCCTGATCTGGCCGGGCGTGG + Intergenic
1086440381 11:86823714-86823736 AATTCAGAGCAGGCCGGGCGCGG + Intronic
1086526871 11:87738156-87738178 AAATAAGAGCAGGCCAGGCGTGG + Intergenic
1086963859 11:93007881-93007903 GAACAATAGGTGGCCGGGCGCGG + Intergenic
1087296164 11:96376716-96376738 GAAGAAAAGCAGGCCAGGCGCGG - Intronic
1087463048 11:98469672-98469694 GATCAAGCTCTGGCTGGGCGCGG + Intergenic
1087558505 11:99753410-99753432 GACAAAAAGCAGGCCGGGCGCGG - Intronic
1088093031 11:106065294-106065316 GAACAAAAACAGGCCGGGCGCGG - Intronic
1088120322 11:106361350-106361372 GAACCAGAGGAGGCTGGGCGCGG - Intergenic
1089521104 11:119064219-119064241 AAACAACAACAGGCCGGGCGTGG + Intergenic
1089819290 11:121209111-121209133 ATACAATAGCAGGCCGGGCGCGG - Intergenic
1090000055 11:122948793-122948815 CTGCAAGAGCAGGCTGGGCGCGG + Intronic
1090040300 11:123284912-123284934 AATGAAGATGAGGCCGGGCGCGG + Intergenic
1090053780 11:123403832-123403854 AATGACAAGCAGGCCGGGCGCGG - Intergenic
1090396324 11:126421510-126421532 GCTCTGGGGCAGGCCGGGCGAGG - Intronic
1090396335 11:126421576-126421598 GCTCTGGGGCAGGCCGGGCGAGG - Intronic
1090784192 11:130033905-130033927 TATAAAGAGTAGGCTGGGCGTGG - Intergenic
1091827285 12:3522373-3522395 AAACAAGCTCAGGCCGGGCGCGG + Intronic
1091843731 12:3638565-3638587 GGACAAGAGCAGTCCGGGAGAGG + Intronic
1091934772 12:4426412-4426434 TAACAAGACCAGGCCGGGCATGG - Intergenic
1091964410 12:4725842-4725864 CTTCAAAAGCAGGCCGGGCGTGG - Intronic
1092373835 12:7939138-7939160 GATCAAGAGATCGCCGGGCGCGG - Intergenic
1092705799 12:11282883-11282905 GTTCAAGACCAGGCCGGACACGG - Intergenic
1093176966 12:15923310-15923332 AAGCAAAAACAGGCCGGGCGCGG - Intronic
1094612518 12:32007887-32007909 GTTACAGAGCAGGCCAGGCGCGG - Intergenic
1095966280 12:47869244-47869266 TAGGAAGAGAAGGCCGGGCGCGG + Intronic
1096020142 12:48317218-48317240 GAAGAATAGCTGGCCGGGCGCGG - Intergenic
1096141869 12:49249135-49249157 AATAAAAAGAAGGCCGGGCGCGG + Intronic
1096257051 12:50069582-50069604 AATAAAGAGGAGGCTGGGCGCGG - Intronic
1096517172 12:52163362-52163384 AATGAAGAGTAGGCCGGGCGCGG + Intergenic
1096768329 12:53913242-53913264 AAGCAAAAGCAGGCCAGGCGCGG - Intergenic
1097064269 12:56309258-56309280 TAGCCAGTGCAGGCCGGGCGCGG + Intronic
1097252551 12:57644376-57644398 GATACAGAGAGGGCCGGGCGTGG - Intergenic
1097861711 12:64524375-64524397 GAGCAAGTACAGGCTGGGCGCGG - Intergenic
1098027561 12:66220808-66220830 AAAGAAGAACAGGCCGGGCGCGG - Intronic
1098058350 12:66533353-66533375 CATAAATATCAGGCCGGGCGTGG + Intronic
1098283167 12:68882010-68882032 AAAAAAAAGCAGGCCGGGCGTGG - Intronic
1098306724 12:69109771-69109793 GATCAAGGCCAGGCCAGGCATGG - Intergenic
1098335774 12:69403011-69403033 GAAAAATAGCAAGCCGGGCGTGG - Intergenic
1098390388 12:69963836-69963858 CATCTAGTGAAGGCCGGGCGCGG + Intergenic
1098535238 12:71586694-71586716 CTTAAATAGCAGGCCGGGCGCGG - Intergenic
1099915522 12:88887861-88887883 AATAAAAAGCAGGCCGGGCGCGG + Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100305728 12:93348373-93348395 GGTGAAGGGCAGGCCGGGCATGG + Intergenic
1100460801 12:94797347-94797369 GATAAAGAAAAGGCCAGGCGCGG - Intergenic
1100968591 12:100041723-100041745 TGACAATAGCAGGCCGGGCGCGG - Intronic
1101037778 12:100721974-100721996 GCTCAAGGTCAGGCCAGGCGTGG - Intronic
1101359896 12:104016344-104016366 GATGATGTGCAGGCCGGGTGTGG + Intronic
1101678714 12:106943591-106943613 AAACCAGAGCAGGCCGGGCGCGG - Intergenic
1101901787 12:108796204-108796226 GGTCAAGATGAGGCCGGGTGTGG - Intronic
1102076763 12:110066094-110066116 GGTCAGGGGCAGGCCGGGCGCGG + Intronic
1102130659 12:110526124-110526146 AATCCACAGCAGGCCAGGCGGGG - Intronic
1102140341 12:110609826-110609848 GAACAAGAATAGGCTGGGCGCGG + Intergenic
1102155943 12:110728107-110728129 ACTCAAGAGCAGGCCAGGCACGG + Intronic
1102876331 12:116451943-116451965 AAAAAAAAGCAGGCCGGGCGAGG - Intergenic
1103494216 12:121349092-121349114 GTTCAAGAGCAGCCTGGGCATGG - Intronic
1103607985 12:122101867-122101889 CTTGAAGAGAAGGCCGGGCGCGG - Intronic
1103631709 12:122266690-122266712 GATCTGGAGTAGACCGGGCGCGG + Intergenic
1103651952 12:122439861-122439883 AAACAAAAACAGGCCGGGCGCGG + Intergenic
1103725158 12:122994161-122994183 AATGCAGAGCTGGCCGGGCGCGG - Intronic
1103756969 12:123215945-123215967 GACCAAGAGAAGGCCGGGCGCGG + Intronic
1103766565 12:123284349-123284371 AAACAAGAATAGGCCGGGCGCGG - Intergenic
1103804610 12:123562708-123562730 GAGGGGGAGCAGGCCGGGCGCGG + Intergenic
1104095551 12:125554131-125554153 TATCAACAGTAGGCCGGGCGCGG + Intronic
1104119201 12:125782715-125782737 TGTCAACAGCAGGCCAGGCGCGG - Intergenic
1104710271 12:130980686-130980708 GAGGAACTGCAGGCCGGGCGCGG - Intronic
1104835976 12:131791100-131791122 GAGCAAGACCTGGCCTGGCGCGG + Intronic
1105070478 12:133231557-133231579 GGTCATGAGGAGGCTGGGCGTGG - Exonic
1105593481 13:21815073-21815095 AATCAGGAGATGGCCGGGCGGGG + Intergenic
1105827698 13:24137118-24137140 AATAAAGAACAGGCCGGGCGCGG - Intronic
1105949376 13:25215690-25215712 GACGAATATCAGGCCGGGCGCGG + Intergenic
1105950436 13:25225034-25225056 AAACAAAAACAGGCCGGGCGCGG + Intergenic
1106390685 13:29332923-29332945 GAACTAGAGAAGGCCGGGCGCGG - Intronic
1106743711 13:32676639-32676661 AAACAAGATCTGGCCGGGCGCGG + Intronic
1106811686 13:33364597-33364619 GAAAAAGAGGAGGCTGGGCGCGG + Intergenic
1107279450 13:38716796-38716818 AAGAAAGAGCAGGCCAGGCGCGG - Intronic
1107783079 13:43926051-43926073 AAACAAGATCAGGCCAGGCGCGG + Intergenic
1107976013 13:45689369-45689391 GATACAGTTCAGGCCGGGCGCGG + Intergenic
1108232747 13:48366826-48366848 GATTAAAAGCAGGCTGGGCGCGG + Intronic
1108273717 13:48787578-48787600 GAGCAAGAGGAGGCCGGGCGCGG + Intergenic
1110047872 13:70854194-70854216 TCTCAAGAGCCGGCTGGGCGCGG - Intergenic
1110107312 13:71693606-71693628 AAGCAAAACCAGGCCGGGCGCGG - Intronic
1111292821 13:86189288-86189310 GTTAAAAAGCAGGCCAGGCGCGG - Intergenic
1112831432 13:103457258-103457280 CATCAAAAGTCGGCCGGGCGCGG - Intergenic
1113111052 13:106823958-106823980 CATGAAGAAGAGGCCGGGCGCGG - Intergenic
1113213537 13:108011223-108011245 GATAAAGAATAGGCCGGGCACGG - Intergenic
1113722040 13:112565642-112565664 GATACACAGCAGGCTGGGCGCGG + Intronic
1113798584 13:113074752-113074774 GACCCAGAGGAGGCCGGGCAGGG - Intronic
1113858830 13:113467751-113467773 AATTAAAAGCGGGCCGGGCGCGG + Intronic
1113866746 13:113531421-113531443 GATCAAGAGCAGCACACGCGTGG + Intronic
1113866760 13:113531531-113531553 GATCAAGAGCAGCACACGCGTGG + Intronic
1113866776 13:113531643-113531665 GATCAAGAGCAGCACGCGTGTGG + Intronic
1113866783 13:113531698-113531720 GATCAAGAGCAGCACGCACGTGG + Intronic
1113993421 14:16047090-16047112 TATCAAGAGAAGGCCAGGCAAGG - Intergenic
1114272325 14:21108808-21108830 GAATAAGAGTGGGCCGGGCGCGG - Intergenic
1114430411 14:22655972-22655994 GAAAAAGAACAGGCCGGGTGTGG - Intergenic
1114442996 14:22766066-22766088 GCTCACGTGCAGGCCGGGCGCGG - Intergenic
1114455792 14:22852851-22852873 GATTAAGGGCAGGCAGGGAGTGG - Intergenic
1114554440 14:23553602-23553624 AACCAAAAACAGGCCGGGCGTGG + Intronic
1115037293 14:28873872-28873894 GGTCAACATCAGGCCGGGCGCGG + Intergenic
1115311311 14:31981019-31981041 AATGTAGAGAAGGCCGGGCGCGG - Intergenic
1115595788 14:34907983-34908005 GATAAAGAACAGGCCGGGCACGG + Intergenic
1116456103 14:45122791-45122813 GATCAGGAATAGGCCAGGCGCGG - Intronic
1117327047 14:54678836-54678858 CCTAAAGATCAGGCCGGGCGCGG - Intronic
1117370729 14:55076255-55076277 GGTAGAGAGCAGGCTGGGCGTGG + Intergenic
1117392843 14:55279004-55279026 GATTTAGTGAAGGCCGGGCGTGG + Intronic
1117552917 14:56853730-56853752 AATAAAGTTCAGGCCGGGCGTGG - Intergenic
1118555166 14:67010258-67010280 AATCAAGAATAGGCCGGGCGCGG + Intronic
1118690175 14:68331071-68331093 GAACAATAGCTGGCCGGGCGCGG + Intronic
1118813348 14:69291498-69291520 GACCAAGAGCAGGGTGGGTGGGG - Intronic
1119223846 14:72929124-72929146 GGCCCAGAGGAGGCCGGGCGGGG - Intronic
1119235489 14:73015672-73015694 GGAAAATAGCAGGCCGGGCGTGG - Intronic
1119503634 14:75152827-75152849 GTTCAAGACCTGGCTGGGCGCGG + Intronic
1119830217 14:77695802-77695824 GATTAATAATAGGCCGGGCGTGG + Intronic
1120120427 14:80673351-80673373 GCACTAAAGCAGGCCGGGCGCGG + Intronic
1120389000 14:83881719-83881741 GACGAAAATCAGGCCGGGCGCGG - Intergenic
1120887620 14:89464072-89464094 GACCACTACCAGGCCGGGCGCGG - Intronic
1121122727 14:91386151-91386173 AAAGTAGAGCAGGCCGGGCGCGG + Intronic
1121386390 14:93530617-93530639 AAACAAAAACAGGCCGGGCGCGG + Intronic
1121763863 14:96468585-96468607 GAAAGAGTGCAGGCCGGGCGTGG - Intronic
1121855077 14:97261123-97261145 AATAAATAACAGGCCGGGCGCGG + Intergenic
1122064560 14:99163202-99163224 AATTAAGACCAGGCCAGGCGTGG - Intergenic
1122444173 14:101757249-101757271 GTTCAAGAGCAGCCTGGGCGTGG - Intergenic
1122589008 14:102832381-102832403 TATCAAGCACTGGCCGGGCGTGG + Intronic
1122627599 14:103092170-103092192 GGTCAGGAGAAGGCCGGGTGGGG - Intergenic
1122670208 14:103366005-103366027 AATAAAAAACAGGCCGGGCGCGG + Intergenic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1122763370 14:104046934-104046956 GAAAAAGAGCAGGCCAGGTGCGG - Intronic
1123628254 15:22242564-22242586 AACCCAGACCAGGCCGGGCGTGG - Intergenic
1124510473 15:30320069-30320091 GAAACAGAGAAGGCCGGGCGCGG - Intergenic
1124732415 15:32210458-32210480 GAAACAGAGAAGGCCGGGCGCGG + Intergenic
1124790673 15:32723290-32723312 AATCAAGAGCAGTCTGGGGGTGG + Intronic
1125503794 15:40255195-40255217 AATCTAGGGTAGGCCGGGCGCGG + Intronic
1125662648 15:41406255-41406277 CAACAAAAACAGGCCGGGCGCGG - Intergenic
1125771917 15:42173955-42173977 GTACAAGACAAGGCCGGGCGCGG + Intronic
1126012465 15:44316463-44316485 GTTAAAGAGCTGGCCCGGCGCGG + Intronic
1126027385 15:44460396-44460418 GATCAAACTGAGGCCGGGCGCGG - Intronic
1126763876 15:51994248-51994270 AACCAAGAGCTGGCCAGGCGCGG - Intronic
1126809722 15:52389660-52389682 AAACAAAAGCTGGCCGGGCGTGG + Intronic
1127045136 15:55017513-55017535 GACCCTGAGCCGGCCGGGCGCGG - Intergenic
1127251340 15:57241380-57241402 GATCAATAATAGGCCGGGTGCGG - Intronic
1127784270 15:62342305-62342327 TAAGAAAAGCAGGCCGGGCGCGG + Intergenic
1128070184 15:64790754-64790776 GAGACAGAGTAGGCCGGGCGTGG - Intergenic
1128277492 15:66365833-66365855 TATGCAGAGCAGGCTGGGCGCGG - Intronic
1128960895 15:72003404-72003426 ACTCAAAAGCAGGCCGGGCGCGG + Intronic
1129131868 15:73505820-73505842 GGAGAAGTGCAGGCCGGGCGCGG - Intronic
1129349442 15:74946419-74946441 AATAAAAAGCAGGCAGGGCGCGG - Intergenic
1129349713 15:74948380-74948402 AACCCAGAGGAGGCCGGGCGCGG + Intergenic
1129873718 15:78958462-78958484 ATTCTAGAGCAGGCCGGGCGTGG - Intergenic
1130423464 15:83772142-83772164 GAGCCAAAGGAGGCCGGGCGTGG - Intronic
1131382206 15:91973338-91973360 GATGAAGAGCAGGCACAGCGAGG + Intronic
1131494163 15:92890494-92890516 GAAATATAGCAGGCCGGGCGCGG - Intronic
1131554522 15:93385676-93385698 GAATTAGAGCAGGCCGGGCGCGG + Intergenic
1131563352 15:93463196-93463218 TATTCAGAGCTGGCCGGGCGTGG + Intergenic
1131673036 15:94641719-94641741 GATCACCAGAAGGCTGGGCGTGG + Intergenic
1132323940 15:100950811-100950833 AAAAAAGAGCAGGCCGGGCGCGG + Intronic
1132487094 16:199479-199501 GATCAAGACCAGGCCAGGCGCGG + Intronic
1132520576 16:385912-385934 TATTCAGAGTAGGCCGGGCGCGG - Intronic
1132869576 16:2109830-2109852 GACCAAGTGCAGGCCGGGTGTGG + Exonic
1132894520 16:2222225-2222247 AAACAAAAACAGGCCGGGCGCGG + Intergenic
1133208288 16:4247387-4247409 AGCCAGGAGCAGGCCGGGCGTGG + Intergenic
1133436172 16:5781913-5781935 GAACAGGAACAGGCCAGGCGTGG + Intergenic
1133788322 16:8989886-8989908 GTTCCAGACCAGGCCGGACGCGG + Intergenic
1134245709 16:12538378-12538400 GTGCAAGGGGAGGCCGGGCGCGG - Intronic
1134542531 16:15079098-15079120 TATGAAGAGGAGGCCGGGCGTGG - Intronic
1134717841 16:16365769-16365791 GACCAAGTGCAGGCCGGGTGTGG - Intergenic
1134873156 16:17670010-17670032 AATTAACAGCAGGCCGGGCATGG - Intergenic
1134956909 16:18386390-18386412 GACCAAGTGCAGGCCGGGTGTGG + Intergenic
1135016382 16:18927451-18927473 GAAAGAGAGAAGGCCGGGCGTGG + Intergenic
1135031684 16:19043860-19043882 AAACAAAAGCAGGCCGGGCGCGG - Intronic
1135032285 16:19047987-19048009 CATCAAGAGTAGGCCGGGTGCGG - Intronic
1135139192 16:19907321-19907343 GATGAAGAGAGGGCCGGGCACGG - Intergenic
1135322018 16:21503307-21503329 GAAAGAGAGAAGGCCGGGCGCGG + Intergenic
1135385888 16:22039542-22039564 GTTCATGAGCAGGCTGGGCATGG + Intronic
1135635730 16:24073850-24073872 GAGCAAGTGATGGCCGGGCGTGG + Intronic
1136132595 16:28233170-28233192 GAAGAGGAGCTGGCCGGGCGTGG + Intergenic
1136181184 16:28553564-28553586 AATTAAAAACAGGCCGGGCGCGG - Intergenic
1136262698 16:29091764-29091786 TATGAAGAGGAGGCCGGGTGTGG + Intergenic
1136333495 16:29596433-29596455 AAGAAAGAGAAGGCCGGGCGCGG + Intergenic
1136407793 16:30058770-30058792 GAAGCAGAGCAGGCCAGGCGTGG - Intronic
1136652305 16:31683275-31683297 GAGTAAGGACAGGCCGGGCGCGG + Intergenic
1136924491 16:34359408-34359430 GATCAAGATCATGCCAGGCATGG - Intergenic
1136980082 16:35052398-35052420 GATCAAGATCATGCCAGGCATGG + Intergenic
1138255142 16:55550623-55550645 GATTAAATGCGGGCCGGGCGTGG + Intronic
1138388703 16:56654255-56654277 GATTCAGAGCCGGCTGGGCGCGG - Intronic
1138393647 16:56688304-56688326 AAACAAAAACAGGCCGGGCGCGG + Intronic
1138557772 16:57782651-57782673 GTTCAAGGACAGGCTGGGCGCGG + Intronic
1138611704 16:58129968-58129990 GAACATGATTAGGCCGGGCGCGG + Intergenic
1138680659 16:58681570-58681592 GATCAAGAGCAGCCCTGGGCAGG + Intronic
1139095317 16:63698206-63698228 AATCAGGTGAAGGCCGGGCGCGG + Intergenic
1139780687 16:69348903-69348925 GATCTTGAACAGGCTGGGCGTGG - Intronic
1139818279 16:69695551-69695573 AATACAGACCAGGCCGGGCGTGG + Intronic
1139820983 16:69721179-69721201 AAGAAAGTGCAGGCCGGGCGTGG - Intronic
1139913480 16:70413423-70413445 AATAAAAAGCTGGCCGGGCGCGG + Intronic
1140225814 16:73075918-73075940 GATGAAAAGCTGGCCGGGTGCGG - Intergenic
1140509578 16:75497173-75497195 AATCATGAACAGGCCGGGCACGG - Intergenic
1140709637 16:77664768-77664790 GATCATGTGCAGGCCAGGCGCGG - Intergenic
1141183490 16:81770766-81770788 GGCCCAGATCAGGCCGGGCGCGG + Intronic
1141824626 16:86470465-86470487 TATGAAGATCAGGCCAGGCGTGG + Intergenic
1141924458 16:87158716-87158738 GAACAAGAGCTGGCCGGGTGTGG + Intronic
1141975691 16:87514760-87514782 AACCCAGACCAGGCCGGGCGTGG + Intergenic
1142314790 16:89336833-89336855 AAACAACTGCAGGCCGGGCGCGG + Intronic
1142523995 17:525396-525418 GATCTAAAGCAGGCAGGGTGTGG + Intronic
1142624387 17:1182654-1182676 GAGCATGAACAGGCCGGGCGCGG - Intronic
1142629872 17:1218077-1218099 GATCAAGAGCATGCTGTCCGAGG - Intronic
1142659486 17:1417947-1417969 AAAACAGAGCAGGCCGGGCGCGG - Intergenic
1142746566 17:1961989-1962011 AAAGAAAAGCAGGCCGGGCGTGG + Intronic
1142753871 17:2004076-2004098 AACAAAAAGCAGGCCGGGCGCGG + Intronic
1142873025 17:2833425-2833447 TACCAAGAACAGGCCAGGCGCGG - Intronic
1142996768 17:3765057-3765079 GCTCATGATGAGGCCGGGCGCGG + Intronic
1143056706 17:4168155-4168177 GATCAAGAGCAGCTCAGGCCAGG + Intronic
1143222510 17:5274492-5274514 GAATAAGAACAGGCCAGGCGCGG + Intergenic
1143308186 17:5965605-5965627 GATCAGGAACAGGCCAGGCGCGG - Intronic
1143438995 17:6953361-6953383 AATCAGGTGCTGGCCGGGCGCGG - Intronic
1143493854 17:7299521-7299543 AATAAAAAACAGGCCGGGCGTGG + Intergenic
1143579296 17:7816088-7816110 GACAAAGAGCTGGCTGGGCGTGG - Intronic
1143785308 17:9251257-9251279 GACCCAGAGGAGGCAGGGCGGGG - Intronic
1143838097 17:9708915-9708937 GAAAAAAAACAGGCCGGGCGTGG - Intronic
1144051652 17:11502117-11502139 GACTAAAAACAGGCCGGGCGCGG + Intronic
1144059213 17:11567533-11567555 GTTTAATAGAAGGCCGGGCGCGG + Intergenic
1144101827 17:11948518-11948540 GAGCCAGAGGAGGCCGGGTGCGG - Intronic
1144394695 17:14832839-14832861 AAGAAAAAGCAGGCCGGGCGCGG - Intergenic
1144701099 17:17340812-17340834 AAACAAGAGCAGGCCGGGCGCGG - Intronic
1144878049 17:18412524-18412546 GATGAGGACAAGGCCGGGCGCGG + Intergenic
1144932378 17:18870241-18870263 AATTAAGTGCAGGCCGGGTGCGG + Intronic
1145154181 17:20531901-20531923 GATGAGGACAAGGCCGGGCGCGG - Intergenic
1146258511 17:31405642-31405664 AATAAAGAGCAGGCTGGGTGCGG - Intronic
1146367449 17:32240001-32240023 AATCAAGTGCAGGCCAGGCGCGG + Intronic
1146724030 17:35142869-35142891 GATCAAGTCAAGGCTGGGCGTGG + Intergenic
1147127742 17:38383832-38383854 AATATAGAGCAGGCTGGGCGCGG - Intronic
1147349260 17:39827285-39827307 GAACAACAACAGGCCGGCCGTGG - Intronic
1147710153 17:42457989-42458011 AATAAAGAGAGGGCCGGGCGCGG + Intergenic
1147975362 17:44244790-44244812 GAGAAGGAGCAGGCCGGGTGTGG + Intergenic
1147999699 17:44380535-44380557 CATCAAGAGGAGGCCAGGCCAGG - Intronic
1148008178 17:44451978-44452000 GATCTTGGGCAGGCTGGGCGTGG + Intronic
1148056561 17:44800983-44801005 TTTTAAGAGCAGGCCAGGCGCGG + Exonic
1148247897 17:46047494-46047516 GAAAAAGTTCAGGCCGGGCGTGG + Intronic
1148588071 17:48795035-48795057 ATTCAAGAATAGGCCGGGCGCGG + Intronic
1148658781 17:49310241-49310263 GAACAACAGAGGGCCGGGCGCGG - Intronic
1148672848 17:49425011-49425033 CAGCAAGAGCAGGCCAGGCATGG - Intronic
1148749451 17:49936046-49936068 GACTAAGAGGAGGCCGGGCTTGG - Intergenic
1148831642 17:50436417-50436439 TAACAACAACAGGCCGGGCGTGG - Intronic
1149488142 17:57060779-57060801 GATCAAGCATAGGCCGGGCGCGG - Intergenic
1149546928 17:57510716-57510738 AACCAAGAGGAGGCCGGGTGTGG - Intronic
1149809384 17:59653481-59653503 GAGGGAGAGGAGGCCGGGCGTGG - Intronic
1149900281 17:60470554-60470576 AATAAAGAGCAGGCTGGGCATGG - Intronic
1150312889 17:64143919-64143941 AGAAAAGAGCAGGCCGGGCGCGG + Intergenic
1150496070 17:65608710-65608732 GTTCAAGAACAGGCCGGGCACGG + Intronic
1150676647 17:67249799-67249821 GGTCCAAAGTAGGCCGGGCGCGG + Intergenic
1150948741 17:69777599-69777621 GAAAAAGAGTAGGCCTGGCGCGG - Intergenic
1150979736 17:70127584-70127606 GATGAAGAGTAGGCCGGTAGAGG - Intronic
1151035366 17:70792622-70792644 GACCCAGAGCAGGCCAGGTGCGG - Intergenic
1151286036 17:73111915-73111937 CTTCAAGGACAGGCCGGGCGCGG + Intergenic
1151488169 17:74415234-74415256 CAACAACAGCAGGCCGGGCACGG + Intergenic
1151614988 17:75204155-75204177 GAACAAGGATAGGCCGGGCGCGG - Intergenic
1151616540 17:75216553-75216575 GATCAACAGAAGGCTGGGCACGG - Intronic
1151722949 17:75868583-75868605 GATAAAGTACAGGCCGGGGGTGG + Intergenic
1151774991 17:76194723-76194745 CCACAAGAGCAGGCCGGGCACGG + Intronic
1151812758 17:76454184-76454206 TATAAAAAGTAGGCCGGGCGCGG + Intronic
1152018241 17:77766071-77766093 GATTTAGAGCAGGCCGGGCGCGG + Intergenic
1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG + Intergenic
1152417954 17:80175266-80175288 GAAAAATAGCAGGCCGGGCATGG - Intronic
1152472593 17:80498725-80498747 GGCCAAGAGCAGGGCGGGAGGGG + Intergenic
1152715673 17:81899411-81899433 GATCAAGGGCAGGAGGGGTGGGG - Exonic
1152853678 17:82651536-82651558 AATCTACAGTAGGCCGGGCGCGG + Intergenic
1152979552 18:263367-263389 GAGCAGCTGCAGGCCGGGCGCGG - Intronic
1153579734 18:6560799-6560821 TATCTAAAGCAGGCTGGGCGTGG - Intronic
1153613504 18:6911122-6911144 TACCAAGAGCTGGCCGAGCGCGG - Intronic
1153670374 18:7406186-7406208 TATCAATTGAAGGCCGGGCGCGG - Intergenic
1153876915 18:9382205-9382227 AAACAAGAGGAGGCTGGGCGAGG + Intronic
1154257855 18:12799919-12799941 GAAAAAGAGGAGGCCGGGCGTGG - Intronic
1154364786 18:13698060-13698082 AATTAAGAACTGGCCGGGCGTGG + Intronic
1154380113 18:13842027-13842049 GATTAAGAACTGGCCGGGTGCGG + Intergenic
1154439487 18:14374930-14374952 CAAAAAGAGCAGGCCGGGCGCGG - Intergenic
1154951534 18:21214942-21214964 AAGCAATAGCAGGCCGGGCCCGG - Intergenic
1155194707 18:23462429-23462451 AAACAAGAACAGGCCAGGCGCGG - Intronic
1155530390 18:26760642-26760664 AATGACTAGCAGGCCGGGCGTGG - Intergenic
1156267095 18:35498681-35498703 GATTAAGAACCGGCCGGGCGTGG - Intergenic
1156286960 18:35706218-35706240 TAGAAAGAGCCGGCCGGGCGCGG + Intronic
1156606014 18:38668363-38668385 GATGCAAAGCAGGCCGGGTGCGG + Intergenic
1157510566 18:48269252-48269274 GAAACAGAGCAGGCCGGGCATGG - Intronic
1158278997 18:55800233-55800255 GAACAAAGCCAGGCCGGGCGCGG - Intergenic
1159005723 18:63008449-63008471 GCGAAACAGCAGGCCGGGCGTGG - Intergenic
1159128915 18:64257579-64257601 AAAAAAAAGCAGGCCGGGCGCGG - Intergenic
1159553763 18:69923661-69923683 AATAAAAATCAGGCCGGGCGCGG + Intronic
1159582666 18:70250506-70250528 ACTTGAGAGCAGGCCGGGCGCGG + Intergenic
1159833789 18:73311617-73311639 TGTCAAGAATAGGCCGGGCGCGG + Intergenic
1160191543 18:76718530-76718552 GAGCAAGACCAGGCCGGGCACGG + Intergenic
1160350365 18:78173355-78173377 CTTTAAGAACAGGCCGGGCGCGG - Intergenic
1160711398 19:552941-552963 GTTAAAGATTAGGCCGGGCGCGG - Intergenic
1160744995 19:707136-707158 GTTTGAGACCAGGCCGGGCGCGG - Intergenic
1160839567 19:1140007-1140029 GAAGAAATGCAGGCCGGGCGCGG + Intronic
1160951728 19:1670849-1670871 GAAAAAGAGTGGGCCGGGCGCGG - Intergenic
1160951901 19:1671865-1671887 GAAGAAGAGCAGGCCGGGTACGG - Intergenic
1161030064 19:2053804-2053826 GAAGAAGAGGAGACCGGGCGCGG - Intergenic
1161161941 19:2766724-2766746 AAGCAAGAAGAGGCCGGGCGCGG - Intronic
1161207481 19:3048803-3048825 AAACAAAAGCAGGCCGGGCGCGG - Intergenic
1161336424 19:3716361-3716383 GTTCAATACCAGGCCGAGCGCGG - Intronic
1161376526 19:3941929-3941951 CAGCAAGAGGGGGCCGGGCGCGG - Intronic
1161487098 19:4542505-4542527 AGTCAAGGCCAGGCCGGGCGCGG - Intergenic
1161986269 19:7656363-7656385 AATGAAGAGCAGTCCAGGCGTGG + Intergenic
1162073149 19:8167021-8167043 GAGCAAGACCCGGCCGGGCGCGG - Intronic
1162129144 19:8514717-8514739 AATAAAGAACTGGCCGGGCGCGG - Intergenic
1162152093 19:8653936-8653958 AATCAACACCAGGCCAGGCGTGG + Intergenic
1162370268 19:10274603-10274625 ATTCATGAGCAGGCCGGGTGTGG - Intronic
1162407956 19:10486904-10486926 ATGCAAAAGCAGGCCGGGCGTGG + Intronic
1162589237 19:11579632-11579654 AAACAAAAACAGGCCGGGCGCGG - Intronic
1162646980 19:12057099-12057121 GCACAGGAGGAGGCCGGGCGCGG - Intergenic
1162940817 19:14007881-14007903 CATAAAAAGTAGGCCGGGCGTGG - Intergenic
1163119901 19:15211181-15211203 GAAAGAGAGCAGGCCAGGCGTGG - Intergenic
1163306711 19:16484465-16484487 CATCGAGAGTTGGCCGGGCGTGG - Intronic
1163401611 19:17096978-17097000 CAGCAACAACAGGCCGGGCGTGG - Intronic
1163604794 19:18268086-18268108 TTTGAAAAGCAGGCCGGGCGCGG - Intronic
1163952013 19:20597456-20597478 AATTAAAAGAAGGCCGGGCGCGG - Intronic
1164000874 19:21097154-21097176 TATCCTGAACAGGCCGGGCGTGG - Intronic
1164074567 19:21802234-21802256 GTTTAAATGCAGGCCGGGCGCGG + Intergenic
1164175690 19:22772004-22772026 GTGCCAGAGCAGGCTGGGCGCGG - Intronic
1164676733 19:30106127-30106149 GAACAGTAGCCGGCCGGGCGTGG + Intergenic
1165048137 19:33122611-33122633 ACTAAAGAGCCGGCCGGGCGTGG - Intronic
1165194093 19:34087686-34087708 GAGAAAGTGCTGGCCGGGCGTGG + Intergenic
1165200458 19:34139496-34139518 GTTCAAGAGAAGGCCGGGAGCGG - Intergenic
1165212206 19:34244896-34244918 AATAAAGAGGAGGCCAGGCGCGG + Intergenic
1165234726 19:34411533-34411555 AACCATGAGCAGGCTGGGCGTGG - Intronic
1165548786 19:36565410-36565432 AATGAAGAACAGGCCGGGCGCGG + Intronic
1165657241 19:37544710-37544732 GAAAAACAGTAGGCCGGGCGTGG - Intronic
1165692508 19:37874529-37874551 CAACAACAACAGGCCGGGCGTGG + Intergenic
1166037012 19:40175900-40175922 AATAAAAAGCAGGCCGGGTGCGG - Intergenic
1166144116 19:40822529-40822551 TAGCTAGAGCTGGCCGGGCGCGG + Intronic
1166183496 19:41124551-41124573 TAGCTAGAGCTGGCCGGGCGCGG - Intronic
1166282883 19:41806975-41806997 GACCAAGACAAGGCCGGGTGCGG - Intronic
1166589266 19:43982435-43982457 GCTTAAAAGCCGGCCGGGCGTGG + Intronic
1166876267 19:45899547-45899569 GAGCAAGTCCAGGCCGGGCGTGG + Intronic
1166924135 19:46254355-46254377 AATAAAGAACAGGCCAGGCGCGG + Intergenic
1167204198 19:48089135-48089157 GAACAACATCAGCCCGGGCGTGG + Intronic
1167261550 19:48461791-48461813 GATGAAGAGGAGGCCGGGCCCGG + Exonic
1167434763 19:49473073-49473095 GATGAAGGCCAGGACGGGCGAGG + Intronic
1167678375 19:50903663-50903685 GAAAAAGAGCTGGCCGGGCGTGG - Intergenic
1167697000 19:51020657-51020679 GATCCTGAGCTGGCCGGGCGCGG + Intergenic
1167832036 19:52031705-52031727 TAGCAAGAGGAGGCCAGGCGTGG + Exonic
1168049396 19:53817443-53817465 GGTTAAGAGGAGGCTGGGCGCGG + Intronic
1168240656 19:55087278-55087300 GAGCGAGGGCAGCCCGGGCGCGG - Intronic
1168495516 19:56844883-56844905 AAGCAATAGCAGGCCGGGTGCGG - Intergenic
1168656706 19:58134643-58134665 AACACAGAGCAGGCCGGGCGCGG + Intronic
925236852 2:2286270-2286292 AATGAAGAACAGGCCGGGTGTGG - Intronic
925367310 2:3319638-3319660 GAGGAAGAGCACACCGGGCGTGG - Intronic
927211453 2:20641464-20641486 GATCACGTGCAGGCTGGGCAGGG - Intronic
927229520 2:20808369-20808391 TAACAAGACAAGGCCGGGCGCGG + Intronic
927495336 2:23548100-23548122 GATAAGGAGCAGGCAGGCCGTGG + Intronic
927500553 2:23580078-23580100 AATCTAGACCAGGCCGGGCGCGG + Intronic
927579012 2:24224918-24224940 ATTTAAGAGCAGGCCAGGCGTGG - Intronic
928434772 2:31247746-31247768 GAGGAAGAGCAGGCCTGACGAGG + Intronic
928611933 2:32999599-32999621 GATCCAGAGGCGGCTGGGCGCGG + Intronic
928908280 2:36391416-36391438 AATCAAAAGTGGGCCGGGCGCGG - Intronic
929044059 2:37773508-37773530 GAGCAAGAGGAGGCTGGGAGGGG + Intergenic
929102599 2:38331010-38331032 GAACAAGACATGGCCGGGCGTGG + Intronic
929378757 2:41324040-41324062 AATAAAAAGCAGGCCGGGCGCGG + Intergenic
929833184 2:45366769-45366791 AAAGAAGAGCAGGCCGGGTGCGG - Intergenic
929906013 2:46047174-46047196 GATTAAGAGCAGGCTGGGCCAGG + Intronic
930406990 2:50971292-50971314 AAACAATAACAGGCCGGGCGTGG + Intronic
930443951 2:51446776-51446798 GAACATGGACAGGCCGGGCGCGG - Intergenic
930493644 2:52109760-52109782 AGTAAAGAGCTGGCCGGGCGCGG + Intergenic
930623337 2:53667715-53667737 AAAAAAGAGCAGGCCGGGCGTGG + Intronic
930769146 2:55114406-55114428 GATTAACTCCAGGCCGGGCGTGG + Intergenic
930779441 2:55209161-55209183 AATAAAGAGGAGGCCGGGCACGG - Intronic
930814296 2:55576450-55576472 AAACAAAAACAGGCCGGGCGCGG + Intronic
930824883 2:55686922-55686944 GATTGAGACCAGGCCAGGCGCGG + Intronic
930955996 2:57203480-57203502 GATCAAAAACAGGCTGGGCATGG - Intergenic
930983373 2:57555062-57555084 AATTATGAGCAGGCCGGGCTTGG - Intergenic
931292149 2:60882382-60882404 GACCAAGTGTAGGCCGGGCGCGG + Intronic
931378783 2:61732641-61732663 TATCTAGAACAGGCCGGGCGCGG - Intergenic
931870081 2:66446839-66446861 GATCTGGGGCAGGCCGGGCCCGG + Intronic
932086818 2:68769848-68769870 GATAAAGAGCAGGATGGGCATGG + Intronic
932242698 2:70170047-70170069 AATAAAAAACAGGCCGGGCGCGG - Intronic
932856288 2:75237084-75237106 AATCAAGAAGAGGCCGGGCGCGG - Intergenic
933348026 2:81115155-81115177 TATCAAGTGCAGGCCCGGCATGG + Intergenic
933706908 2:85298201-85298223 AAAAAAGTGCAGGCCGGGCGCGG + Intronic
933717462 2:85371741-85371763 TAGCAAGAGTAGGTCGGGCGTGG + Intronic
933902875 2:86861926-86861948 GGTGAGGAGCTGGCCGGGCGGGG + Intergenic
934027794 2:88015620-88015642 GATAAAAAGGAGGCCGGGCGTGG - Intergenic
934522070 2:95025854-95025876 GATGAAGAGCAAGTCGGGCAAGG - Exonic
934749174 2:96781267-96781289 GTTCGAGATCAGGCCGGGCACGG - Intronic
934864553 2:97794324-97794346 ATTCATGAGCAGGCCGGGCACGG - Intronic
935232447 2:101110684-101110706 GAACCAGAACAGGCCAGGCGCGG + Intronic
935777670 2:106487344-106487366 GGTGAGGAGCTGGCCGGGCGGGG - Intergenic
935872210 2:107463431-107463453 AAACAGAAGCAGGCCGGGCGCGG + Intergenic
936030144 2:109064177-109064199 GGTAAATGGCAGGCCGGGCGGGG + Intergenic
936054340 2:109249972-109249994 GATCTGGTGCAGGCCGGGCGCGG - Intronic
936102920 2:109599165-109599187 ACTCAAGTGGAGGCCGGGCGCGG + Intronic
936134557 2:109878483-109878505 AAACAAAAACAGGCCGGGCGCGG - Intergenic
936210140 2:110493002-110493024 AAACAAAAACAGGCCGGGCGCGG + Intergenic
936349926 2:111704819-111704841 AAAAAAGAGCAGGCTGGGCGTGG + Intergenic
936552295 2:113456006-113456028 TAACAAGTTCAGGCCGGGCGTGG - Intronic
936697267 2:114965686-114965708 GATAAAGAGGAGGCCGGGCGCGG + Intronic
937571461 2:123367787-123367809 GATTAAGACTTGGCCGGGCGCGG - Intergenic
937933272 2:127221741-127221763 AAAAAAGAGCAGGCCGGGCGCGG + Intergenic
938538259 2:132263772-132263794 TATCAAGAGAAGGCCAGGCACGG + Intergenic
938791985 2:134684633-134684655 CCTTAAAAGCAGGCCGGGCGAGG + Intronic
940210289 2:151249671-151249693 GATCACAAGTTGGCCGGGCGTGG - Exonic
940226819 2:151409536-151409558 GACTAAGAGCTGGCCGGGCGCGG - Intergenic
940542205 2:155034972-155034994 AAGTAACAGCAGGCCGGGCGCGG - Intergenic
941383131 2:164820509-164820531 AATTAACAGCAGGCCTGGCGCGG - Intronic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
941834072 2:169996987-169997009 AATCCAAAGCAGGCCGGGCATGG - Intronic
942098784 2:172557763-172557785 GATTAAGTGCAGTCCGGGCATGG - Intronic
942149649 2:173062453-173062475 GATAAAAATCAGGCCGGGCGTGG - Intergenic
942181555 2:173385434-173385456 AATGAAAAACAGGCCGGGCGTGG + Intergenic
942341751 2:174956478-174956500 AATGAATAACAGGCCGGGCGTGG + Intronic
942395375 2:175541503-175541525 AATCAAGATCAGGCCAGGTGCGG - Intergenic
943030679 2:182681934-182681956 GAGAAAGAGTAGGCCGGGCATGG - Intergenic
943438902 2:187901758-187901780 TAGCCAGGGCAGGCCGGGCGCGG + Intergenic
943869397 2:192974754-192974776 AATAAAGATTAGGCCGGGCGCGG + Intergenic
944553953 2:200869724-200869746 GTCCATGAGCAGGCCGGGTGTGG + Intergenic
944778219 2:202991111-202991133 GATAAAGAACTGGCCGGGCGCGG + Intronic
944847384 2:203682210-203682232 GCTCAAGAGGAAGCCGGGTGGGG + Intergenic
945081238 2:206088036-206088058 AATCCAGAATAGGCCGGGCGCGG - Intergenic
945181407 2:207095336-207095358 GAACAAAAACAGGCCGGGCGTGG - Intronic
945299961 2:208206938-208206960 GACCAAAAAAAGGCCGGGCGCGG + Intergenic
945330918 2:208538057-208538079 GAGAGAGAGGAGGCCGGGCGCGG + Intronic
945389581 2:209247665-209247687 AAGCAACAGGAGGCCGGGCGCGG + Intergenic
945448301 2:209964496-209964518 TAACAAGATAAGGCCGGGCGCGG + Intronic
945545925 2:211151609-211151631 GATGATTAACAGGCCGGGCGCGG + Intergenic
945929595 2:215841790-215841812 ATTCAGGAGCAGGCCGGGCACGG + Intergenic
946028440 2:216686820-216686842 GATCAAGACCATCCTGGGCGTGG - Intronic
946139888 2:217681425-217681447 AATCAGCACCAGGCCGGGCGCGG + Intronic
946388926 2:219404048-219404070 AAGCATGAGCAGGCCAGGCGCGG + Intergenic
946433989 2:219640233-219640255 GAACAAGAGAAGGAGGGGCGGGG - Intronic
946981037 2:225215379-225215401 TAGCACGAGTAGGCCGGGCGCGG - Intergenic
947803054 2:232943940-232943962 CTACAAGTGCAGGCCGGGCGCGG + Intronic
947964702 2:234269484-234269506 GACCAAGTGCTGGCCGGGCATGG - Intergenic
948052183 2:234987060-234987082 AACCATTAGCAGGCCGGGCGGGG - Intronic
948065113 2:235072510-235072532 GATCACAAACTGGCCGGGCGCGG + Intergenic
948135517 2:235633301-235633323 GGGCATGAGCGGGCCGGGCGTGG + Intronic
948297080 2:236868664-236868686 AATTAAGACCAGGCCGGGCGCGG - Intergenic
948351067 2:237341253-237341275 GATCAAAAGCGGGCCGGAAGCGG + Intronic
948492073 2:238320328-238320350 GTGCCAGAGCAGGCGGGGCGCGG - Intergenic
948772620 2:240259231-240259253 GAGCAAGAGGAGGCGGGGAGCGG + Intergenic
1169345956 20:4828260-4828282 AAACAGGAGCCGGCCGGGCGTGG + Intergenic
1169413243 20:5392739-5392761 GATCAAGACCAGCCTGGGCAAGG - Intergenic
1169456950 20:5760400-5760422 GACCAAGATGAGGCCGGGCTTGG + Intronic
1169622804 20:7526921-7526943 AATAATGTGCAGGCCGGGCGCGG - Intergenic
1170110474 20:12799192-12799214 AATCAAAGACAGGCCGGGCGCGG + Intergenic
1170468976 20:16649316-16649338 GATCAAGATGAGGTCAGGCGTGG - Intergenic
1170563457 20:17578668-17578690 GAGCAAGAAGTGGCCGGGCGTGG + Intronic
1170623734 20:18015028-18015050 GAGCAAAATCAGGCCGGGCGCGG + Intronic
1171050763 20:21856511-21856533 GAACAAGAGAAGGCTGGGCACGG + Intergenic
1171225790 20:23441047-23441069 GAAAAAGAGCTGGCCGGGCGTGG - Intronic
1172071807 20:32262887-32262909 GACCACGAACAGGCCAGGCGTGG + Intergenic
1172087527 20:32398897-32398919 AAACAAAACCAGGCCGGGCGCGG - Intronic
1172389156 20:34554660-34554682 AAACAAAAACAGGCCGGGCGCGG - Intronic
1172406354 20:34692667-34692689 CAACAACAACAGGCCGGGCGCGG - Intergenic
1172422428 20:34828653-34828675 GATAAAGGCCAAGCCGGGCGCGG + Intergenic
1172718308 20:36980410-36980432 GCTCAAGAGTTGGCTGGGCGTGG + Intergenic
1172724780 20:37030562-37030584 GTTCAAAAACAGGCCCGGCGTGG + Intronic
1173042674 20:39478957-39478979 AAACAAGGGCAGGCCGGGCATGG + Intergenic
1173556700 20:43971346-43971368 GACCAAGGGAAGGCGGGGCGAGG + Intronic
1173788774 20:45813811-45813833 GATTAAGGGGAGGCTGGGCGCGG + Intronic
1173835214 20:46120610-46120632 AATCAAGAGCAGGCCTGGGAGGG + Intronic
1174312345 20:49667541-49667563 AAACAACAACAGGCCGGGCGCGG - Intronic
1174363676 20:50043735-50043757 GAGGCAGAGCCGGCCGGGCGCGG - Intergenic
1174466442 20:50721249-50721271 AAAGAAGAGCAGGCCGGGCACGG - Intergenic
1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG + Intronic
1174788135 20:53452307-53452329 GAACTAGAGCAGGCCAAGCGTGG + Intronic
1175076587 20:56380064-56380086 CAAAAAGAGCAGGCCGGGCACGG + Intronic
1175188934 20:57198484-57198506 CATCAGGAGGAGGCCGAGCGGGG - Intronic
1175637938 20:60601161-60601183 AATCGAGACCAGGCCGGGTGTGG - Intergenic
1176213480 20:63937359-63937381 AAACAAAAACAGGCCGGGCGCGG - Intergenic
1177034394 21:16024005-16024027 AAGCAAGAACAGGCCAGGCGTGG + Intergenic
1177152049 21:17464986-17465008 CATCAGCAACAGGCCGGGCGTGG + Intergenic
1177219368 21:18171495-18171517 GAACTAAAGAAGGCCGGGCGCGG - Intronic
1177369234 21:20180123-20180145 AGCCAAGAGCTGGCCGGGCGCGG - Intergenic
1178310024 21:31522159-31522181 TATTAAGAGCCGGCCGGGCGTGG - Intronic
1178949115 21:36971536-36971558 TTTCAAGAGCCGGCTGGGCGCGG + Intronic
1179175453 21:39004985-39005007 GTTCAAGAGGAGGCCTGGCGTGG - Intergenic
1179518522 21:41926483-41926505 GCTGAAGAGCAGGCTGAGCGGGG + Intronic
1179826740 21:43970294-43970316 TGTTAACAGCAGGCCGGGCGTGG - Intronic
1179990519 21:44946022-44946044 AACAAAGACCAGGCCGGGCGTGG - Intronic
1180206209 21:46262675-46262697 AATAAAAAGGAGGCCGGGCGCGG + Intronic
1180313847 22:11260423-11260445 TATCAAGAGAAGGCCAGGCAAGG + Intergenic
1180341502 22:11623134-11623156 TATCAAGAGAAGGCCAGGCACGG - Intergenic
1180625019 22:17188587-17188609 GACCAGGAGCAGGCCAGGCGTGG + Intronic
1180736297 22:18020101-18020123 CATCAGCAGCTGGCCGGGCGCGG - Intronic
1181088346 22:20455352-20455374 GATCAAGAGCAGAGCAAGCGAGG - Intronic
1181789422 22:25252734-25252756 AATCAAGATCAGGCCGAGCGCGG + Intergenic
1182272870 22:29166646-29166668 GACCAAGATCAGGCCAGGCGCGG + Intronic
1182288893 22:29264160-29264182 GCTCAGGAGCAGGCCTGGCAGGG + Exonic
1182361023 22:29746574-29746596 AATCCAGAGCAGGCAGGGCATGG - Intronic
1182423630 22:30260480-30260502 GAGCCAGGGCAGGCCGAGCGTGG + Intergenic
1182727821 22:32461881-32461903 GAGCAAAAATAGGCCGGGCGTGG + Intronic
1182883589 22:33754624-33754646 AATGAAGAGCTGGCCGGGCACGG - Intronic
1182902888 22:33913120-33913142 TATCAAAATCAGGCCGGGCTTGG - Intronic
1183020583 22:35023083-35023105 GTTCAAGAGCAGGCCAGCCTCGG - Intergenic
1183151496 22:36041407-36041429 GAACAAGAACAGGCCAGGCGCGG + Intergenic
1183159838 22:36105179-36105201 CAGCAAGAGCAGGCTGGGTGTGG - Intergenic
1183160027 22:36106730-36106752 AAGCAAGAGCAGGCCGGGTGCGG - Intergenic
1183173559 22:36205403-36205425 CAACAAGAGCAGGCCTGGTGCGG - Intergenic
1183179801 22:36252429-36252451 CAACAAGAGCAGGCCTGGTGCGG + Intergenic
1183621273 22:38974288-38974310 AAGCAAGGGCAGGCCGGGCGCGG - Intronic
1183850028 22:40577894-40577916 GATCAGATGTAGGCCGGGCGTGG - Intronic
1183913715 22:41099321-41099343 AAACAAAAACAGGCCGGGCGCGG - Intronic
1183941798 22:41300039-41300061 GGCCAGGAGGAGGCCGGGCGCGG - Intergenic
1183996560 22:41637832-41637854 AATCAGAAGCAGGCTGGGCGCGG + Intronic
1184380459 22:44142085-44142107 GATGAGGAGAGGGCCGGGCGCGG + Intronic
1184381886 22:44149863-44149885 TATCATGGGCAGGCTGGGCGCGG + Intronic
1184466981 22:44674430-44674452 GTTCAAGACCAGGCCGGGTACGG + Intronic
1184531293 22:45057372-45057394 GTTCAAGACCAGCCCGGGCCTGG + Intergenic
1184611271 22:45605293-45605315 GACTGAGATCAGGCCGGGCGCGG - Intergenic
1184623796 22:45705722-45705744 TAACAAGTGGAGGCCGGGCGCGG - Intronic
1184704668 22:46202445-46202467 AATTAAAAGCAGGCCGGGCACGG + Intronic
1184970230 22:48014489-48014511 AATCAAAAGGAGGCCGGGCATGG - Intergenic
1203296181 22_KI270736v1_random:44904-44926 GAGCAAGAGGAGGCTGGGAGGGG + Intergenic
949929793 3:9069656-9069678 TAGCAAGAGCGGGCTGGGCGCGG + Intronic
950061896 3:10078642-10078664 AAGCAAGATGAGGCCGGGCGCGG - Intronic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
950394626 3:12724510-12724532 GAAGAAGAGGTGGCCGGGCGTGG - Intergenic
951329543 3:21349666-21349688 GATGTAAAGCTGGCCGGGCGTGG + Intergenic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
951896873 3:27617843-27617865 GATAAAGACCTGGCCGGGCAAGG + Intergenic
951912026 3:27760836-27760858 AAACAAAACCAGGCCGGGCGCGG + Intergenic
953131338 3:40142341-40142363 AATCAACAGCAGGCCGGGTGCGG - Intronic
953495410 3:43382227-43382249 AACCAAGATCAGGCCGGGCGCGG + Intronic
953795119 3:45979148-45979170 ACTCCAGAACAGGCCGGGCGCGG - Intronic
953963566 3:47284625-47284647 TAAGAAGAGCAGGCTGGGCGCGG - Intronic
954010826 3:47636451-47636473 GATTAAAAACAGGCCGGGCCGGG + Intronic
954182231 3:48890477-48890499 AAGAAAGATCAGGCCGGGCGCGG - Intronic
954252128 3:49376129-49376151 TAGCAAGAACAGGCCAGGCGTGG - Intronic
954342790 3:49968956-49968978 AAAAAAAAGCAGGCCGGGCGCGG - Intronic
954405024 3:50340843-50340865 TAGCAAGCGCGGGCCGGGCGGGG + Intronic
954487604 3:50868360-50868382 AAACAAAAGCAGGCCGGGCATGG - Intronic
954542748 3:51406051-51406073 AAACAAAAACAGGCCGGGCGTGG + Intronic
955277363 3:57558929-57558951 GATAAAAAACAGGCCGGGCCTGG + Intronic
955285432 3:57636644-57636666 GATAAAAAGTTGGCCGGGCGTGG + Intronic
955303120 3:57802554-57802576 GACAAAGAGCAGGCTGAGCGCGG - Intronic
955400114 3:58585514-58585536 GTTCCAGAGCGGGCCGCGCGGGG + Intronic
956094314 3:65700151-65700173 AATCAATAGCAGGCTGGGCGCGG + Intronic
956606502 3:71078120-71078142 TATACAGAGGAGGCCGGGCGGGG - Intronic
957832715 3:85544286-85544308 AAAAAAGAGGAGGCCGGGCGCGG + Intronic
958739464 3:98051456-98051478 AATTAAAAGTAGGCCGGGCGCGG + Intergenic
958868868 3:99533553-99533575 AAGAAAGAGCAGGCCGGGCATGG + Intergenic
959057427 3:101582028-101582050 TAGAAAGAGTAGGCCGGGCGTGG - Intronic
959667176 3:108935101-108935123 GAGCAAGAACAGGCCAGGTGTGG - Intronic
960076478 3:113491328-113491350 TATCTATAGCAGGCCGGGCGTGG + Intronic
960078518 3:113515328-113515350 GGTATATAGCAGGCCGGGCGCGG + Intergenic
960334595 3:116400765-116400787 AAACAAGATCAGGCCGGGAGTGG - Intronic
961358994 3:126356040-126356062 GATAAACAGCAGGCCTGGCCGGG - Intronic
961689166 3:128656023-128656045 GATCGAAACCAGGCTGGGCGCGG + Intronic
961739418 3:129023620-129023642 AATCAAGAGGTGGCCAGGCGCGG - Intronic
961835371 3:129653735-129653757 TAGCAAGAACAGGCCGGGCATGG - Intronic
962266305 3:133946822-133946844 GATCAAAAGTGGGCCGGGCGGGG + Intronic
964071104 3:152634353-152634375 GATCAGCATCAGGCCGGGCGCGG - Intergenic
964106568 3:153046631-153046653 AACCAAAAGCAGGTCGGGCGCGG - Intergenic
964134215 3:153326163-153326185 AATCAAAAGTTGGCCGGGCGTGG - Intergenic
964240706 3:154590204-154590226 AATAAATACCAGGCCGGGCGCGG - Intergenic
964628233 3:158779826-158779848 AATCAAAAAGAGGCCGGGCGTGG - Intronic
965020722 3:163226768-163226790 AATTAAGACCTGGCCGGGCGCGG - Intergenic
966494732 3:180567367-180567389 GAACAATAACCGGCCGGGCGCGG + Intergenic
966720234 3:183055111-183055133 GATAAAAAGCTGGCCGGGTGCGG + Intronic
966744840 3:183265591-183265613 GATCGGGCGCAGGCCGGGGGAGG + Intronic
967250760 3:187535915-187535937 GATCAAGTTCTGGCTGGGCGCGG + Intergenic
967284924 3:187859720-187859742 AATCAAGTATAGGCCGGGCGTGG + Intergenic
967347583 3:188475610-188475632 TATGAAAAGCAGGCCGGGCGTGG + Intronic
967595932 3:191327203-191327225 GAACTAGGGGAGGCCGGGCGTGG + Intronic
967634661 3:191787446-191787468 AATGATGAACAGGCCGGGCGCGG + Intergenic
967735957 3:192952834-192952856 AACCAGCAGCAGGCCGGGCGCGG + Intergenic
967811007 3:193761118-193761140 GACCTGGCGCAGGCCGGGCGCGG + Intergenic
968178853 3:196575163-196575185 GAGGAAGAGAGGGCCGGGCGTGG + Intronic
968202172 3:196764090-196764112 AAGCAGCAGCAGGCCGGGCGCGG - Intronic
968270010 3:197396204-197396226 GATGAAGGTGAGGCCGGGCGCGG + Intergenic
968376759 4:50290-50312 TATAAATAGCCGGCCGGGCGCGG + Intergenic
968566041 4:1313437-1313459 GAACAGAAGCAGGCTGGGCGCGG + Intronic
968823763 4:2877675-2877697 AATCAAGAGGGGGCCGGGTGTGG + Intronic
968851630 4:3084396-3084418 CATCAAGATCAGGTCGGACGTGG + Intronic
969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG + Intronic
969210303 4:5682198-5682220 TAGCAATAGCAGGCCGGGGGCGG + Intronic
969251640 4:5972291-5972313 AATTGAAAGCAGGCCGGGCGCGG - Intronic
969569404 4:7999858-7999880 CCCCAAGAGCAGGCCTGGCGGGG - Intronic
969595311 4:8145472-8145494 AATCAATACCTGGCCGGGCGCGG - Intronic
970218600 4:13784723-13784745 TACCAAAAGCAGGCCGGGCGCGG + Intergenic
970239628 4:13994908-13994930 AATAAATAGCTGGCCGGGCGCGG - Intergenic
971715135 4:30166356-30166378 TACTGAGAGCAGGCCGGGCGTGG + Intergenic
971816469 4:31496938-31496960 GATCCAGTGTGGGCCGGGCGCGG + Intergenic
972547312 4:40092932-40092954 AAAAAAGAGCAGGCCGGGCACGG - Intronic
972664620 4:41152616-41152638 AAACAAGTGAAGGCCGGGCGCGG - Intronic
972893995 4:43596405-43596427 TTCTAAGAGCAGGCCGGGCGTGG + Intergenic
973165381 4:47070620-47070642 GGGCAAGTGCAGGCCGGGCGCGG - Intronic
973653075 4:53016816-53016838 GATCAAGATCTGGCCAGGTGCGG + Intronic
973674144 4:53247567-53247589 TAACAAGATCAGGCCGGGCGCGG + Intronic
973833058 4:54781148-54781170 GATGTAGACCAGGCCGGGCATGG - Intergenic
974127793 4:57717189-57717211 GAACTAGAGAAGGCCGGGCGCGG + Intergenic
974244078 4:59291045-59291067 GAGCAAGACCTGGCTGGGCGCGG + Intergenic
974610906 4:64214260-64214282 GATAAACTACAGGCCGGGCGCGG - Intergenic
975151060 4:71021363-71021385 TAGAAATAGCAGGCCGGGCGCGG - Intronic
975778099 4:77811257-77811279 GATCAAGAAAGGGTCGGGCGCGG + Intronic
976108352 4:81643534-81643556 GATTCTCAGCAGGCCGGGCGTGG - Intronic
976415524 4:84769710-84769732 TAATAAAAGCAGGCCGGGCGCGG - Intronic
977941857 4:102868356-102868378 AATCCAAAGCTGGCCGGGCGCGG - Intronic
978101635 4:104848550-104848572 TATCAAGGTCAGGCCGGGCGTGG - Intergenic
978174340 4:105710517-105710539 AAACAAAAACAGGCCGGGCGCGG - Intronic
978587360 4:110288208-110288230 GTTCAAGACCAGGCCTGGCATGG - Intergenic
979389431 4:120110236-120110258 GAATAACAGCAGGCTGGGCGCGG - Intergenic
979653977 4:123169769-123169791 AATATAGAACAGGCCGGGCGCGG - Intronic
980777789 4:137459089-137459111 TAACAATAGCAGGCCTGGCGCGG - Intergenic
980825468 4:138066920-138066942 GATAAAGAAATGGCCGGGCGCGG + Intergenic
981314850 4:143332028-143332050 TATCCAAATCAGGCCGGGCGAGG - Intergenic
981727099 4:147860150-147860172 TAACAGGAGAAGGCCGGGCGTGG + Intronic
982922075 4:161288374-161288396 AATCAAAAAGAGGCCGGGCGCGG + Intergenic
983479227 4:168253091-168253113 GATGCACAGCAGGCCGGGCACGG - Intronic
983506316 4:168557332-168557354 GAACAAGTGGAGGCCGGGAGTGG - Intronic
983559335 4:169085486-169085508 GAGCATGGGCAGGCCGGGTGTGG + Intergenic
983943548 4:173561959-173561981 AATCCAGATTAGGCCGGGCGTGG + Intergenic
984218812 4:176948168-176948190 GAACAGGATTAGGCCGGGCGCGG + Intergenic
984348347 4:178560428-178560450 GAACAAAAAAAGGCCGGGCGCGG + Intergenic
984450520 4:179895190-179895212 AATCAAGAGTTGGCCGGGCATGG - Intergenic
984693642 4:182757020-182757042 GATCTTCAGGAGGCCGGGCGCGG + Intronic
984766859 4:183406482-183406504 AATAAAAAGGAGGCCGGGCGCGG + Intergenic
985210598 4:187588624-187588646 GATCAAGAGATGGCTGGGCGTGG - Intergenic
985504420 5:271000-271022 AAGCAAAAGCAGGCCGGGCGCGG - Intergenic
986028438 5:3872473-3872495 GATACAGAGCAGGCAGGGCACGG + Intergenic
986397547 5:7345173-7345195 GATCAAGCTGAGTCCGGGCGCGG - Intergenic
986550894 5:8953732-8953754 TATCAAAAGCTGGCCGGGCGTGG - Intergenic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
987376003 5:17235550-17235572 CATAAAGAGCAGGCCAGGCGTGG - Intronic
987544040 5:19289222-19289244 GATCATAAACTGGCCGGGCGCGG + Intergenic
987943491 5:24573409-24573431 AGACAAAAGCAGGCCGGGCGCGG + Intronic
988000658 5:25343433-25343455 GAAAGAGAGAAGGCCGGGCGCGG - Intergenic
988036492 5:25833530-25833552 GATAAAAATTAGGCCGGGCGCGG - Intergenic
988141605 5:27249826-27249848 AACCAACAACAGGCCGGGCGCGG + Intergenic
988490015 5:31698303-31698325 GAAAAAGAGAAGGCCGGGTGCGG + Intronic
988536333 5:32072438-32072460 GCTGGAGACCAGGCCGGGCGCGG + Intronic
989145416 5:38244731-38244753 GATGAAGATGAGGCCGGGCACGG - Intergenic
989236584 5:39154880-39154902 AATTAAAAGGAGGCCGGGCGAGG - Intronic
989381893 5:40817468-40817490 GTTCGAGACCAGGCTGGGCGTGG + Intergenic
989527976 5:42475166-42475188 AATCAAGGGCAGGCTGGGCGCGG - Intronic
989753713 5:44925616-44925638 GATGAGAAGGAGGCCGGGCGCGG - Intergenic
990529668 5:56660738-56660760 GAGCAGTAACAGGCCGGGCGCGG + Intergenic
990963472 5:61419110-61419132 TATAAAGAGGAGGCCGGGCGTGG - Intronic
992542184 5:77776212-77776234 GATCAAGATCAAGACCGGCGTGG - Exonic
992579591 5:78158037-78158059 GAAAAAGAGTAGGCCGGGCATGG - Intronic
992953737 5:81886992-81887014 TAAGAAAAGCAGGCCGGGCGCGG - Intergenic
993269448 5:85775333-85775355 GAGCAATAACAGGCCGGGTGTGG + Intergenic
993723068 5:91340942-91340964 AATAAAGAGGAGGCCGGGCATGG + Intergenic
993782238 5:92081507-92081529 TATCAAGTGCAGGCTGGGCGCGG - Intergenic
994581546 5:101648823-101648845 TAATAAGAACAGGCCGGGCGCGG + Intergenic
994872291 5:105367131-105367153 GAAAATGAGGAGGCCGGGCGTGG - Intergenic
995049298 5:107684208-107684230 AGTCCAGAACAGGCCGGGCGTGG + Intergenic
995136913 5:108688987-108689009 AATCAACAAAAGGCCGGGCGCGG + Intergenic
995576890 5:113546028-113546050 AATGGAGATCAGGCCGGGCGCGG - Intronic
995879290 5:116826084-116826106 GATGCAGATCAGGCCAGGCGCGG + Intergenic
996359335 5:122628089-122628111 ATTCTAGAGCTGGCCGGGCGCGG - Intergenic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
997282638 5:132658424-132658446 GGTCATGAGCAGGCTGGGCCTGG + Intronic
997292636 5:132748317-132748339 GAAGAAGAGCAGGTGGGGCGAGG - Intronic
998075280 5:139231471-139231493 AAGCAAAAGAAGGCCGGGCGCGG + Intronic
998120539 5:139573009-139573031 TATCAAGATGAGGCTGGGCGCGG + Intronic
998272468 5:140719140-140719162 AACCAAAAACAGGCCGGGCGCGG + Intergenic
998345965 5:141463734-141463756 GAAGAGAAGCAGGCCGGGCGCGG - Intronic
998473409 5:142400938-142400960 GGGCAAGAAGAGGCCGGGCGCGG + Intergenic
998488365 5:142523608-142523630 ATTCACCAGCAGGCCGGGCGCGG - Intergenic
999206953 5:149855824-149855846 AAACAAGAACAGGCTGGGCGCGG + Intergenic
999454627 5:151704893-151704915 AATAAAGTGTAGGCCGGGCGCGG + Intergenic
999533399 5:152488202-152488224 GATATAGAGTAGGCCAGGCGTGG + Intergenic
1000004757 5:157173134-157173156 AATAAAGATCAGGCTGGGCGCGG + Intronic
1000050623 5:157559973-157559995 GAGGTAGTGCAGGCCGGGCGCGG + Intronic
1000922222 5:167151805-167151827 GAAGAAAAGCAGGCCAGGCGCGG - Intergenic
1001030330 5:168257902-168257924 AATCAGGAGCTGGCCGGGCACGG - Intronic
1001552663 5:172615694-172615716 GATCCAAAAGAGGCCGGGCGTGG + Intergenic
1001711373 5:173781146-173781168 AATCAGCAGCAGGCCGGGAGCGG + Intergenic
1001779231 5:174353579-174353601 AAACTAGAGCAGGCCGGGCGCGG - Intergenic
1001813352 5:174647509-174647531 AACAAAGGGCAGGCCGGGCGCGG + Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002487374 5:179548840-179548862 AAACAAGACCAGGCCGGGCGTGG + Intergenic
1002569606 5:180132678-180132700 AAGCAAGACCAGGCCGGGCGCGG + Intronic
1002592802 5:180302937-180302959 GATGAATTCCAGGCCGGGCGTGG + Intronic
1002687675 5:181027140-181027162 GATATAGAGTGGGCCGGGCGCGG + Intergenic
1002918886 6:1551767-1551789 GATGTAGAGATGGCCGGGCGTGG + Intergenic
1003039024 6:2670073-2670095 GATTAAGACCAGGCCAGGCCCGG + Intronic
1003159531 6:3623456-3623478 GTTTAAGATGAGGCCGGGCGCGG - Intergenic
1003182338 6:3802687-3802709 GAAAAAGGACAGGCCGGGCGCGG - Intergenic
1003201903 6:3969216-3969238 GCTTTAGAGCAGGCCGGGTGTGG + Intergenic
1003640422 6:7870917-7870939 GATCCAAGACAGGCCGGGCGCGG - Intronic
1003856310 6:10279777-10279799 GAAAAAGAACAGGCCGGGTGTGG + Intergenic
1003894130 6:10590840-10590862 GGTCAAAATTAGGCCGGGCGCGG - Intronic
1004565817 6:16796571-16796593 GAAAATGAACAGGCCGGGCGTGG + Intergenic
1004604002 6:17176866-17176888 GATAAAGACCAGGCCAGGCATGG - Intergenic
1004688556 6:17971713-17971735 AAACAAGAGCAAGCCGGACGTGG - Intronic
1004936177 6:20510622-20510644 GAATAACAGCAGGCTGGGCGTGG + Intergenic
1005519669 6:26588527-26588549 AACCAAAATCAGGCCGGGCGCGG - Intergenic
1005565243 6:27086106-27086128 AATCAAGAAAAGGTCGGGCGCGG + Intergenic
1005634315 6:27738900-27738922 AAAGAAGAGCGGGCCGGGCGCGG - Intergenic
1005634557 6:27740910-27740932 GAGCATAAGGAGGCCGGGCGCGG + Intergenic
1006002203 6:30973994-30974016 GAAGAAGAAGAGGCCGGGCGTGG + Intergenic
1006019341 6:31108594-31108616 AATTAAGAGTAGGCCGGGCATGG - Intergenic
1006323204 6:33333180-33333202 GAACAAGATCAGGCCAGGCGCGG + Intergenic
1006484460 6:34327240-34327262 GATCAAAGACAGGCCGGGCGCGG + Intronic
1006514853 6:34540008-34540030 AATTTAGGGCAGGCCGGGCGTGG + Intronic
1006842639 6:37039654-37039676 GATGCTGAGCAGGCCGGGCGTGG + Intergenic
1007576459 6:42928275-42928297 AATAAAGAGGAGGCCGGGCTTGG - Intergenic
1007770953 6:44192027-44192049 GAGCAAGAAGAGGCCGGGTGCGG - Intergenic
1008959067 6:57247144-57247166 AATCAAGTCCAGGCCGGGCGCGG - Intergenic
1009240614 6:61182017-61182039 GATATATAACAGGCCGGGCGCGG + Intergenic
1009350215 6:62666441-62666463 GAACAAGAGAAGGCCTGGTGCGG + Intergenic
1009575694 6:65456160-65456182 TAAAAAGAACAGGCCGGGCGAGG + Intronic
1009695066 6:67091957-67091979 GAGCAAGAGCAGCACGGGTGTGG - Intergenic
1010648115 6:78418202-78418224 GATACAAAGCAGGCCGGGCGTGG - Intergenic
1011175226 6:84552408-84552430 AAACAAAAACAGGCCGGGCGCGG - Intergenic
1011514560 6:88138816-88138838 ATTTAAGAGCTGGCCGGGCGCGG + Intergenic
1011893948 6:92200938-92200960 AAGTTAGAGCAGGCCGGGCGCGG + Intergenic
1012371609 6:98514075-98514097 GATGAGGAGCAGGCCTGGCCTGG + Intergenic
1012698214 6:102417355-102417377 GATGAAGAGCAGGGAGGGCAGGG - Intergenic
1013029740 6:106321646-106321668 GATTAAGAGTTGGCCAGGCGCGG - Intronic
1013115970 6:107103999-107104021 AAAAAAGAGAAGGCCGGGCGTGG + Intronic
1013122064 6:107149832-107149854 GAACAATATCAGGCCGGGCGCGG - Intergenic
1013322930 6:109012822-109012844 GATAAGCAGTAGGCCGGGCGTGG + Intronic
1013335293 6:109152471-109152493 GATAAAGTCTAGGCCGGGCGTGG - Intronic
1013498399 6:110721673-110721695 GAGTAAGATCAGGCCGGGCATGG + Intronic
1013520753 6:110931112-110931134 TATCAGGGGCTGGCCGGGCGTGG + Intergenic
1014035238 6:116759595-116759617 AATAAAGATCAGGCCGGGCGCGG - Intronic
1014480288 6:121927845-121927867 GCTAAAGAGCCGGCCGGGTGCGG + Intergenic
1015528570 6:134197533-134197555 AAGCAAAAGTAGGCCGGGCGTGG + Intronic
1016079939 6:139843590-139843612 GAAAAAAAGGAGGCCGGGCGAGG - Intergenic
1016082225 6:139870329-139870351 TAGCCAGAGCAGGCCAGGCGCGG + Intergenic
1016093427 6:140007017-140007039 AAATATGAGCAGGCCGGGCGGGG + Intergenic
1017632454 6:156410247-156410269 CATCAATGGCGGGCCGGGCGAGG + Intergenic
1017797183 6:157856037-157856059 AATCAATGACAGGCCGGGCGTGG - Intronic
1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG + Intronic
1018195004 6:161347904-161347926 AAGTTAGAGCAGGCCGGGCGCGG - Exonic
1018282559 6:162203385-162203407 GATCAAGGTCAGGCCAGTCGTGG + Intronic
1018409207 6:163524755-163524777 AATAAACAGAAGGCCGGGCGTGG - Intronic
1018515892 6:164579775-164579797 GAGGAAAAGCAGGCCGGGCATGG - Intergenic
1018682981 6:166280261-166280283 GTACAAGAGCTGGCCGGGTGCGG - Intergenic
1018758219 6:166867810-166867832 AAGAAAGTGCAGGCCGGGCGTGG + Intronic
1019349497 7:547574-547596 GAGAAACAGCAGGCCGGGCACGG - Intergenic
1019652416 7:2167255-2167277 CATGATTAGCAGGCCGGGCGCGG + Intronic
1019939219 7:4276098-4276120 GAACAAAAGGAGGCCAGGCGCGG + Intergenic
1020063495 7:5169959-5169981 GGTCAAGAGCAGGCCAGGTATGG + Intergenic
1020177396 7:5893393-5893415 GATCATGTCCTGGCCGGGCGTGG - Intergenic
1020224370 7:6268458-6268480 TTACAAGAGCAGGCCGGGCGCGG - Intronic
1020530088 7:9322286-9322308 AAACTAGAACAGGCCGGGCGCGG - Intergenic
1020691600 7:11361588-11361610 ACTCAATAGAAGGCCGGGCGCGG - Intergenic
1021730563 7:23591506-23591528 GAAAAAGAGCTGGCCGGGCGCGG - Intergenic
1021949458 7:25760733-25760755 GATCATGAGCCAGCCGGGCGTGG + Intergenic
1022076783 7:26979147-26979169 TAACAAAAGCAGGCTGGGCGTGG - Intronic
1022342626 7:29483109-29483131 AAAAAAGTGCAGGCCGGGCGCGG - Intronic
1022587556 7:31628744-31628766 AATCACGCTCAGGCCGGGCGCGG - Intronic
1022665549 7:32406983-32407005 AAACAAAAACAGGCCGGGCGCGG + Intergenic
1022905423 7:34850688-34850710 CCTCAAGGACAGGCCGGGCGCGG - Intronic
1023607279 7:41942183-41942205 GTTCAACAACTGGCCGGGCGTGG + Intergenic
1024291896 7:47811087-47811109 GATCAAGATCAAGCCTGGTGAGG - Intronic
1024327199 7:48118150-48118172 AATAAAGAACAGGCCGGGTGTGG - Intergenic
1024875527 7:54018625-54018647 GATCAAATTCAGGCCAGGCGTGG + Intergenic
1025016457 7:55442824-55442846 AATAAAAAGCAGGCCGGGTGCGG + Intronic
1026973440 7:74481447-74481469 AAACAAAAGCAGGCTGGGCGTGG - Intronic
1027190139 7:75991833-75991855 AATAAAGAGTGGGCCGGGCGTGG - Intronic
1027353838 7:77337858-77337880 AATCAAGGGCAGGCCAGGTGTGG + Intronic
1028117183 7:87012119-87012141 GGTCAATATCTGGCCGGGCGTGG + Intronic
1028133931 7:87207303-87207325 AAGCAAAAGCCGGCCGGGCGCGG + Intronic
1028805707 7:95023840-95023862 GAACTAGAGAAGGCCGGGCATGG - Intronic
1028959333 7:96731712-96731734 CATGAAAAGCAGGCCGGGCGCGG + Intergenic
1029081438 7:97977608-97977630 GATCATGTTCTGGCCGGGCGCGG + Intergenic
1029281644 7:99439279-99439301 GATCCAGAGGAAGCCGGGGGAGG - Intronic
1029414852 7:100436240-100436262 GCTCAAGTCCAGGCCGGGCTCGG + Exonic
1029475669 7:100782619-100782641 GTTCTAGAGCAGGCCGGACACGG - Intronic
1029522318 7:101071099-101071121 AATCAATAGCAGGCCAGGCATGG + Intergenic
1029547261 7:101217039-101217061 CCTCAAGAGCACGCTGGGCGGGG + Intronic
1029654416 7:101914787-101914809 AATCATGGACAGGCCGGGCGAGG - Intronic
1029733819 7:102454638-102454660 GCTCCAGAGCAGGCCCAGCGGGG - Exonic
1029992470 7:104974757-104974779 AATCAAATGTAGGCCGGGCGCGG + Intergenic
1030250688 7:107440961-107440983 TATCAATCCCAGGCCGGGCGTGG + Intronic
1031812714 7:126392028-126392050 GAGAATGATCAGGCCGGGCGCGG - Intergenic
1031926418 7:127642863-127642885 AGTCAAGAGCAGGCCAGGTGCGG - Intergenic
1032165417 7:129541130-129541152 GAGCAAGACCAGGCCAGGCATGG - Intergenic
1032224402 7:130019337-130019359 AAACCAGTGCAGGCCGGGCGTGG - Intronic
1033715287 7:143995722-143995744 AATCAATTGCCGGCCGGGCGCGG - Intergenic
1033805010 7:144944007-144944029 GATCAAGAAAAGGCCGGGCACGG - Intergenic
1034206515 7:149320534-149320556 GAGCAGGAGCAAGCGGGGCGGGG + Intergenic
1034230018 7:149516674-149516696 AATAAAAAGCAGGCCAGGCGCGG + Intergenic
1034251517 7:149695230-149695252 AAACAAGAAGAGGCCGGGCGTGG + Intergenic
1034619752 7:152447601-152447623 GGTCAAGAACTGGCCGGGCACGG - Intergenic
1034674600 7:152883498-152883520 GATCAAGCGCAGTTCGGGTGCGG - Intergenic
1035131606 7:156659893-156659915 GACCAAGAGCAGTCGGGGCAGGG + Intronic
1035234479 7:157487524-157487546 GATGAAGACCAGGGCGGGCAGGG + Intergenic
1035548324 8:500914-500936 GAACATGAGCAGGCCGGGCGCGG + Intronic
1036061352 8:5324974-5324996 TAGGCAGAGCAGGCCGGGCGCGG + Intergenic
1036524335 8:9520957-9520979 GTTTAATTGCAGGCCGGGCGCGG + Intergenic
1036953547 8:13163688-13163710 GATCAAGATCTGGCCAGACGTGG + Intronic
1037168405 8:15859082-15859104 GAGTGAGAGTAGGCCGGGCGCGG - Intergenic
1037170412 8:15885495-15885517 AATTAAGAGTCGGCCGGGCGCGG + Intergenic
1037371855 8:18188705-18188727 GAAAAACATCAGGCCGGGCGTGG + Intronic
1037578094 8:20226705-20226727 TATCCAGAACAGGCCGGGCGCGG - Intronic
1037687094 8:21150132-21150154 GAACTGGAACAGGCCGGGCGCGG + Intergenic
1037913433 8:22757874-22757896 GACCAAGAGCAGCCCAGGCAGGG - Intronic
1037942847 8:22966492-22966514 GCTCAACATCAGGCCGGGTGTGG + Intronic
1037964732 8:23125268-23125290 AAACAAGAGCCGGCCGGGCGCGG - Intergenic
1037984263 8:23277244-23277266 GATTAAAAAGAGGCCGGGCGTGG - Intronic
1038192312 8:25334428-25334450 GATCCAGAATAGGCCAGGCGTGG + Intronic
1038725369 8:30077511-30077533 GAGCAAAAAGAGGCCGGGCGTGG + Intronic
1038749367 8:30281688-30281710 TTTGAAAAGCAGGCCGGGCGCGG + Intergenic
1041391918 8:57354536-57354558 AAGAAAGATCAGGCCGGGCGTGG + Intergenic
1041633960 8:60121582-60121604 ATTAAATAGCAGGCCGGGCGCGG + Intergenic
1042049661 8:64689856-64689878 AAACAGAAGCAGGCCGGGCGTGG - Intronic
1042537211 8:69870915-69870937 GAACCAGAGCAAGCCGGGCATGG + Intergenic
1043439023 8:80260587-80260609 GATCAGTAAGAGGCCGGGCGCGG + Intergenic
1045160439 8:99536237-99536259 GATTAAAATCAGGCCGGGCACGG - Intronic
1045857096 8:106776943-106776965 AATCCACAGCTGGCCGGGCGCGG - Intergenic
1046804218 8:118462810-118462832 GATAAAAAGTGGGCCGGGCGCGG + Intronic
1047786227 8:128156265-128156287 GCTGAAGAGCTGGCCGGGCACGG - Intergenic
1048000304 8:130374464-130374486 GTTCAAGACTAGGCCGGGCGCGG + Intronic
1048352235 8:133625428-133625450 GGTCTTGAGTAGGCCGGGCGCGG + Intergenic
1048665939 8:136661560-136661582 AAGAAATAGCAGGCCGGGCGCGG + Intergenic
1049233957 8:141499767-141499789 ACCCAAAAGCAGGCCGGGCGCGG + Intergenic
1049431236 8:142566248-142566270 GAGCCAGAGCTGGCCGGGCAGGG - Intergenic
1049754176 8:144301574-144301596 GCTCCAGAAGAGGCCGGGCGCGG + Intronic
1049900709 9:161176-161198 TAACAAGTTCAGGCCGGGCGTGG + Intronic
1049977649 9:875098-875120 GATTAAGTGTTGGCCGGGCGCGG - Intronic
1050576303 9:6999374-6999396 TATTAAAAACAGGCCGGGCGCGG + Intronic
1050612906 9:7371804-7371826 GAAAAATAGTAGGCCGGGCGCGG + Intergenic
1050756339 9:9008514-9008536 AATGAAGGGGAGGCCGGGCGCGG - Intronic
1050842395 9:10169182-10169204 GAATAAAAGCAGGCCGGGCGCGG + Intronic
1050974854 9:11924863-11924885 AATCACCAGCAGGCCGGGCACGG - Intergenic
1051272867 9:15372143-15372165 GATCCTAAACAGGCCGGGCGTGG - Intergenic
1051277915 9:15414945-15414967 AATCTAGACCAGGCCGGGCGCGG + Intergenic
1051440862 9:17081100-17081122 CATCAAGGTCAGGCCGGGCGTGG - Intergenic
1051465994 9:17378467-17378489 GAACAAAAGAAGGCCGGGTGCGG - Intronic
1051690434 9:19706666-19706688 AATCAAGACCCGGCCGGGCGCGG - Intronic
1051707737 9:19898450-19898472 GATAAAGAATAGGCCTGGCGCGG + Intergenic
1052839555 9:33280265-33280287 AAACAACAACAGGCCGGGCGCGG - Intronic
1053080799 9:35174874-35174896 GTTCAAGACGTGGCCGGGCGCGG - Intronic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053720614 9:40943278-40943300 GAGCAAAAGCAGGCCGGGTGTGG + Intergenic
1053743746 9:41171459-41171481 TAACAAGTTCAGGCCGGGCGTGG + Intronic
1053837238 9:42152721-42152743 ACTAAAGTGCAGGCCGGGCGCGG + Intergenic
1053867254 9:42452944-42452966 ACTCAAAACCAGGCCGGGCGCGG + Intergenic
1054345373 9:63908878-63908900 GAGCAAAAGCAGGCCGTGTGTGG - Intergenic
1054349023 9:64001276-64001298 TAACAAGTTCAGGCCGGGCGTGG + Intergenic
1054483524 9:65693845-65693867 TAACAAGTTCAGGCCGGGCGTGG - Intronic
1054814716 9:69464091-69464113 GATCCTGAGCAGGCTGGGCTGGG - Intronic
1055946494 9:81695795-81695817 AATAAAAAGAAGGCCGGGCGCGG - Intergenic
1055961177 9:81821871-81821893 TATAAAGAGATGGCCGGGCGCGG + Intergenic
1055965631 9:81862476-81862498 GAGAAAGAGGGGGCCGGGCGCGG - Intergenic
1056339318 9:85609569-85609591 AACCAAGATCTGGCCGGGCGCGG - Intronic
1056387447 9:86110770-86110792 AATCAATGGCAGGCTGGGCGTGG - Intergenic
1056648575 9:88437053-88437075 GACACAGAGGAGGCCGGGCGCGG - Intronic
1056661141 9:88544244-88544266 GAGCAGGAGCAGGCTGGGTGGGG + Intronic
1056962108 9:91134422-91134444 ACCCAACAGCAGGCCGGGCGCGG - Intergenic
1057111041 9:92471483-92471505 GATCAAGACCCGGCTGGGTGCGG - Intronic
1057138949 9:92715296-92715318 GACCATGAGCAGACCCGGCGTGG - Exonic
1057183788 9:93044564-93044586 CATCAAGAACAGGCCAGGTGCGG + Intergenic
1057248538 9:93480469-93480491 GATACAGAGCAGGCTGGGCCAGG + Intronic
1057639935 9:96809660-96809682 AAACAAGATCCGGCCGGGCGCGG + Intergenic
1058061785 9:100505121-100505143 AATTAAAAGCAGGTCGGGCGCGG + Intronic
1058673733 9:107382441-107382463 AATCATCACCAGGCCGGGCGCGG + Intergenic
1058686000 9:107480269-107480291 GAACAAGTGGAGGCCGCGCGTGG + Intergenic
1058806433 9:108596709-108596731 AATCAAGAGCAGGCCTGACCTGG - Intergenic
1059134573 9:111793170-111793192 GATCAGTGACAGGCCGGGCGCGG - Intronic
1059201267 9:112419292-112419314 TGTCAAGGACAGGCCGGGCGTGG - Intronic
1059230411 9:112716330-112716352 AATGAATAGCAGGCCGGGAGCGG - Intronic
1059535608 9:115077478-115077500 TATGATGAGGAGGCCGGGCGTGG - Intronic
1059854951 9:118386002-118386024 GATATATAACAGGCCGGGCGCGG - Intergenic
1060109220 9:120894605-120894627 TGCCAAGAGAAGGCCGGGCGCGG + Intronic
1060257416 9:122044817-122044839 TATCAAAAACAGGCTGGGCGAGG + Intronic
1060275006 9:122175822-122175844 GAGCAAGGAGAGGCCGGGCGCGG + Intronic
1060301600 9:122377480-122377502 TAGCAAGAGCAGGCCGGGGCGGG - Intronic
1060642178 9:125248332-125248354 TATGAAGAGCTGGCCGGGCGCGG + Intergenic
1060646669 9:125286432-125286454 GGTCAAGAGCTGGCCAGGAGTGG - Intronic
1060974560 9:127756920-127756942 AAACAAGAACAGGCCAGGCGTGG - Intronic
1061017795 9:127992507-127992529 AAACAACAACAGGCCGGGCGCGG - Intergenic
1061058440 9:128237557-128237579 GAACAAGGACAGGCCGGGCGGGG - Intronic
1061216190 9:129223403-129223425 GAAGCAGAGCGGGCCGGGCGTGG - Intergenic
1061332066 9:129901114-129901136 AATGACGAGAAGGCCGGGCGCGG + Intronic
1061350592 9:130061651-130061673 TAGCCAGGGCAGGCCGGGCGTGG + Intronic
1061364820 9:130167017-130167039 AAACAAAACCAGGCCGGGCGTGG - Intergenic
1061411487 9:130424474-130424496 TATTAAGGACAGGCCGGGCGCGG - Intronic
1061922626 9:133790464-133790486 CAGCAAGAACAGGCTGGGCGCGG - Intronic
1062575235 9:137203642-137203664 AAGCAAAAGCAGGCCAGGCGTGG - Intronic
1062646126 9:137549275-137549297 GTTCAAGACTAGGCCGGGCACGG + Intronic
1203572471 Un_KI270744v1:143956-143978 TATAAATAGCCGGCCGGGCGCGG - Intergenic
1185548041 X:961523-961545 GAAAAAAAGCAGGCTGGGCGCGG - Intergenic
1185628607 X:1500146-1500168 AAACAACAACAGGCCGGGCGCGG - Intronic
1186100281 X:6148802-6148824 GAACCAGTGCAGGCCAGGCGCGG - Intronic
1186737211 X:12478282-12478304 AAACCAGAGTAGGCCGGGCGTGG + Intronic
1186779761 X:12900962-12900984 GCTCAAAAGCCTGCCGGGCGCGG + Intergenic
1186801469 X:13096577-13096599 TATACAGAGGAGGCCGGGCGTGG - Intergenic
1186825433 X:13335059-13335081 TATGAAGATCTGGCCGGGCGTGG - Intergenic
1187321821 X:18246029-18246051 GAGCCAGAACAGGCCAGGCGCGG - Intronic
1187421647 X:19139542-19139564 TATAAAGGGCTGGCCGGGCGTGG - Intergenic
1187888569 X:23912239-23912261 GATAAAGAAAGGGCCGGGCGTGG - Intronic
1187890728 X:23932702-23932724 TAGCAACAGGAGGCCGGGCGTGG + Intronic
1188020305 X:25149802-25149824 TGCCAAGAACAGGCCGGGCGCGG - Intergenic
1188054205 X:25522670-25522692 GTCCAAAGGCAGGCCGGGCGCGG - Intergenic
1188581104 X:31715252-31715274 GATTAAGAGCTGGCCGGGCGCGG + Intronic
1189080047 X:37961072-37961094 AATCTGGAGGAGGCCGGGCGCGG - Intronic
1189327825 X:40123641-40123663 GAAAAAAAGAAGGCCGGGCGCGG - Intronic
1189790686 X:44600732-44600754 TATGAAGGGCAGGCCGGGCACGG - Intergenic
1190124755 X:47694023-47694045 AGGCAAGAGAAGGCCGGGCGCGG - Intergenic
1190492685 X:50998982-50999004 GTTTAAGGCCAGGCCGGGCGCGG + Intergenic
1190841286 X:54147023-54147045 AAAGAAAAGCAGGCCGGGCGTGG + Intronic
1190957715 X:55211904-55211926 AGTCATGACCAGGCCGGGCGTGG + Intronic
1192327333 X:70143899-70143921 GATGATGAGCAGGCTGGGCGCGG + Intronic
1192993761 X:76490186-76490208 AATCAACTCCAGGCCGGGCGTGG - Intergenic
1193512291 X:82417867-82417889 GATTATCAGCTGGCCGGGCGCGG + Intergenic
1194284169 X:91989270-91989292 GAAGAAAAGAAGGCCGGGCGCGG + Intronic
1194305003 X:92233003-92233025 TATTTAGGGCAGGCCGGGCGCGG - Intronic
1194631077 X:96284887-96284909 GATCAAGACCAGGAAGGGAGAGG + Intergenic
1194815134 X:98431733-98431755 CAACAACAACAGGCCGGGCGCGG - Intergenic
1194817746 X:98464802-98464824 AATGAAAAGCAGGCCGGGCGTGG - Intergenic
1195028149 X:100899222-100899244 TACTAAGAACAGGCCGGGCGTGG + Intergenic
1195495019 X:105521232-105521254 TAGCTATAGCAGGCCGGGCGCGG - Intronic
1195584905 X:106553683-106553705 GATCAAGAGTAGGCCAGGCACGG + Intergenic
1195778292 X:108432543-108432565 AAACAAGAGGAGGCCGGGTGCGG + Intronic
1195903069 X:109818485-109818507 GAAAAAGGGGAGGCCGGGCGCGG - Intergenic
1196013074 X:110908740-110908762 GAACTAGAGAAGGCCGGGAGTGG - Intergenic
1196100425 X:111841999-111842021 GATCAATCCCAGGCTGGGCGTGG - Intronic
1196102794 X:111865222-111865244 GTTCAAGACCAGGCTGGGGGGGG - Intronic
1196436310 X:115677807-115677829 AAACAAGAACAGGCCAGGCGCGG + Intergenic
1196484385 X:116187644-116187666 GCTCAACATCTGGCCGGGCGCGG - Intergenic
1196630003 X:117927275-117927297 GATCCAGGCCAGGCCGGGAGGGG - Intronic
1196645215 X:118110665-118110687 GAGCAAGAGAAGGCCGGGCATGG - Intronic
1196710601 X:118757979-118758001 AAATAAGAGCAGGCTGGGCGCGG - Intronic
1198653611 X:138890217-138890239 GAAAAAGTTCAGGCCGGGCGTGG - Intronic
1200206243 X:154318407-154318429 GTTCGAGACCAGGCCGGGTGCGG + Intronic
1200211382 X:154348190-154348212 AATCAACAGCAGGCCCGGCCGGG - Intergenic
1200247943 X:154535799-154535821 GTACGAGAGCAGGCGGGGCGGGG + Intronic
1200614844 Y:5367674-5367696 GATTAGAACCAGGCCGGGCGCGG - Intronic
1200670074 Y:6077721-6077743 CAGCAAGAGCCGGCTGGGCGCGG - Intergenic
1200764362 Y:7068009-7068031 AAACTAGAGCAGGCCAGGCGCGG + Intronic
1201698877 Y:16858142-16858164 AATCACAAGCAGGCCGGGCGTGG + Intergenic