ID: 951811358

View in Genome Browser
Species Human (GRCh38)
Location 3:26703752-26703774
Sequence CTGAATATACAAACGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 7, 2: 29, 3: 68, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951811358 Original CRISPR CTGAATATACAAACGGACAG TGG (reversed) Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
907040953 1:51258904-51258926 CTAAATATACAAAGGCCCAGTGG - Intronic
907096717 1:51788588-51788610 CAGAACATACAATCTGACAGAGG - Intergenic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
908500829 1:64742513-64742535 ATAAATATGCAAACGGATAGTGG - Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909675145 1:78231137-78231159 CTGAATATAGAAGCAGACATAGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
913260135 1:116990383-116990405 CTGAAGATATGAAAGGACAGAGG - Intergenic
913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG + Intergenic
914017320 1:143832121-143832143 CAGAATATACAATCGAACAATGG + Intergenic
914655931 1:149740653-149740675 CAGAATATACAATCGAACAATGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918366169 1:183810141-183810163 ATGAATACTCAAAGGGACAGAGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923504242 1:234591770-234591792 CTGAATATAGAAACAGAAGGAGG - Intergenic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1064064674 10:12171352-12171374 CAGAATAGACAAACTGATAGAGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066785529 10:39000033-39000055 GAGAATATACAAAGGGACATTGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1067185246 10:44021642-44021664 ATGAATTTAGAAAGGGACAGAGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069440168 10:68421286-68421308 CTGGGTTTACAAATGGACAGAGG - Intronic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071690975 10:87818958-87818980 CTGAATACACAAACTGCCGGTGG + Intronic
1073992979 10:109284856-109284878 TTGAATATATAAACGGTCTGTGG - Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081422998 11:42894295-42894317 CTAAATATGCAAATGGACTGTGG - Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1081836551 11:46160174-46160196 CTGCCTGTACAAACGGGCAGAGG + Intergenic
1081902424 11:46640316-46640338 CTGAATATACTAACAGACAGTGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1088212539 11:107472709-107472731 CAGAATGACCAAACGGACAGAGG + Intergenic
1089016020 11:115166282-115166304 CTGAATATTCAAAGGCACAGAGG + Intergenic
1090037716 11:123263282-123263304 CTGGCTATACTAACGGACAATGG - Intergenic
1091938272 12:4450756-4450778 CTGAATCTGCAAAGGGGCAGAGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094001946 12:25705196-25705218 CTGAATATTCAAACAGCCAATGG + Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098057204 12:66520619-66520641 CTGGATATACACACAGATAGTGG + Intronic
1099433306 12:82614855-82614877 CAGCCTATACAAAGGGACAGGGG - Intergenic
1100261785 12:92939150-92939172 CATAATATTCAAACGTACAGAGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1106944509 13:34811735-34811757 CTCAATATACAAAGGGATAGGGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1107945439 13:45413889-45413911 CTTAATATCAAAACCGACAGAGG - Intronic
1108037627 13:46308158-46308180 GTTGATATACAAAAGGACAGGGG - Intergenic
1108144781 13:47464652-47464674 CTGAAAATTCAAAAGGCCAGAGG + Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110661716 13:78065515-78065537 CCGAATATGCAAACAGACAGTGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1111986072 13:95068231-95068253 CTGAATATACACACAAAAAGTGG + Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114211352 14:20617795-20617817 ATTACTATACAAACAGACAGTGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115537595 14:34387768-34387790 CTGAAAATACATACAGAGAGGGG - Intronic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1122456354 14:101855299-101855321 CTGAATGCAGAAGCGGACAGGGG - Intronic
1129881773 15:79011390-79011412 CTGAACATAGGAAGGGACAGAGG + Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1135492213 16:22919315-22919337 CTGAATGTACCAACGAACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1138027293 16:53532050-53532072 CTGAATATCCCAAGGGACACAGG + Intergenic
1140470833 16:75213457-75213479 CTGAATACACACGCGAACAGGGG - Intergenic
1142567131 17:847653-847675 CTTTATATAGAAACGGACTGTGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1151483860 17:74386558-74386580 CTGACTCTACAAATGGCCAGCGG - Intergenic
1152144645 17:78561065-78561087 CTGAATATGCAAACAAGCAGTGG + Intronic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1154128275 18:11713618-11713640 CTGAATATATAAACAGGCAATGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155793345 18:30001697-30001719 CTGAATTTACAAATGGATGGTGG - Intergenic
1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG + Intergenic
1156946517 18:42839749-42839771 ATGAACATACGAATGGACAGTGG + Intronic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158091617 18:53721261-53721283 GGGAATATACAAAGGCACAGTGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164434992 19:28221366-28221388 CTGGACATACAACTGGACAGTGG - Intergenic
1166579090 19:43877013-43877035 CGGAATAGAAAAAAGGACAGTGG + Intronic
925175959 2:1784071-1784093 ATGAAAATACAAGCGGACAATGG + Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
926875450 2:17471741-17471763 CTGAATATAAGAAGTGACAGTGG + Intergenic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
931928091 2:67097080-67097102 CTGCATATGCAAAGGGTCAGAGG + Intergenic
932799293 2:74725364-74725386 ATGAAAATACAAGAGGACAGAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933386374 2:81616124-81616146 CTGAAAAGACAAACGGACTGAGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938807828 2:134823026-134823048 CTAAATATAGAAAGGGCCAGAGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941288331 2:163643355-163643377 CACAATATACAAATGTACAGGGG + Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946437618 2:219668355-219668377 CTGAATATAAAAATGCCCAGAGG - Intergenic
946635348 2:221719016-221719038 CTGCATATACAAGCAGACAATGG + Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174714049 20:52737837-52737859 CTAGATAAACAAACAGACAGAGG + Intergenic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1183064232 22:35352604-35352626 CTGAAAAAACAAGCGGACATGGG - Intergenic
950902522 3:16510912-16510934 CAGAATATACAAACAAACTGTGG + Intronic
951065799 3:18264121-18264143 CTTAATATACAAAAATACAGAGG + Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952854137 3:37753685-37753707 ATTAATTTACAAACTGACAGAGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954749591 3:52806080-52806102 CTGCAGATACAAAGGGAGAGAGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
962856815 3:139354232-139354254 CTCAATATAAAAACCAACAGTGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966555286 3:181252123-181252145 CTAAACATACAAACAGGCAGAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968537519 4:1143834-1143856 CTGAATATATAAAGGAACACGGG + Intergenic
968867957 4:3225770-3225792 CTGAGGACAGAAACGGACAGAGG - Intronic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971745295 4:30572196-30572218 GAGAATATACAAACAGACACTGG + Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
980556215 4:134409008-134409030 CTGATTATGCAAGCAGACAGAGG - Intergenic
980933859 4:139207666-139207688 CTAAATATATAAACAGAGAGAGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
984142293 4:176018737-176018759 CTCAATATACAAAAGAATAGTGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987665466 5:20932771-20932793 CTGAATATAACAAAAGACAGAGG + Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
988303213 5:29461213-29461235 ATGCATATACAAAGGGAGAGGGG - Intergenic
988757226 5:34269407-34269429 CTGAATATAACAAAAGACAGAGG - Intergenic
989174284 5:38507141-38507163 CAGTATATACAAACTGACTGCGG + Intronic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
998106824 5:139474024-139474046 CAGAATATAAAAAGGAACAGAGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1002953261 6:1837261-1837283 CTGTATTTACAAAAGGGCAGGGG + Intronic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004045526 6:12019241-12019263 CTGAGTAAGCAAAGGGACAGAGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006214245 6:32426125-32426147 CTGGATATAGAAACAGACAATGG + Intergenic
1008415194 6:51231651-51231673 CAGAATATATAAAAGCACAGAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012775091 6:103487261-103487283 CTGAATATCCAAATGGGGAGAGG + Intergenic
1012775274 6:103488468-103488490 CCTAATATCCAAAAGGACAGAGG + Intergenic
1012987478 6:105890251-105890273 CTTAAAAAACAAAAGGACAGGGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014073510 6:117210775-117210797 CTGAATAAACAAAGGAAGAGAGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018929397 6:168230659-168230681 CTGAATATACGAAGGGACGCTGG + Intergenic
1019519263 7:1453332-1453354 ATGCAGATACAAACTGACAGGGG + Intronic
1022592101 7:31673387-31673409 CTGAAAATAGAAACAGACAATGG - Intergenic
1023313720 7:38913732-38913754 CTGAATATATAAAGGGGCACTGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1027843120 7:83339388-83339410 CTGAATAAATAAATGGCCAGAGG - Intergenic
1028379400 7:90182051-90182073 CTGAATATATACAGTGACAGAGG + Intronic
1028624218 7:92859710-92859732 CTGAATATAAAAAGGCCCAGGGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1031619906 7:123923588-123923610 CTGCTTCTACAAACTGACAGAGG - Intergenic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034075095 7:148223947-148223969 CTGAGGATACAAACACACAGAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041338779 8:56819083-56819105 CTGAATAGACAAACAGATTGTGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1043275978 8:78393296-78393318 CTGAATATATAAACTTACATTGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046065102 8:109186907-109186929 CTGAATATAGAAACTGAGTGAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1052034505 9:23665080-23665102 CTGAATATATATAGTGACAGGGG - Intergenic
1052810347 9:33052906-33052928 CTTAATATACAAACATCCAGGGG + Intronic
1053601644 9:39616948-39616970 CTGAATATTAAAACAGACAGTGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053859292 9:42370715-42370737 CTGAATATTAAAACAGACAGTGG + Intergenic
1054251891 9:62725498-62725520 CTGAATATTAAAACAGACAGTGG - Intergenic
1054566004 9:66759999-66760021 CTGAATATTAAAACAGACAGTGG - Intergenic
1055020543 9:71664558-71664580 CAGAATATAGAAACGGGGAGAGG + Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060862620 9:126967356-126967378 CTGAAAAAAGAAAAGGACAGAGG - Intronic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1186096777 X:6110878-6110900 CTGAATCTGCACACAGACAGAGG + Intronic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1195954602 X:110316830-110316852 CTTAATGTACAAACTGACCGTGG + Intronic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199431606 X:147767375-147767397 CTTAATATACAAACAGGCACAGG - Intergenic
1200671048 Y:6091809-6091831 CTGAATACACAAAAGGTAAGTGG - Intergenic
1200781479 Y:7220248-7220270 CTGAAAATATAAACAGACAATGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic