ID: 951816041

View in Genome Browser
Species Human (GRCh38)
Location 3:26756069-26756091
Sequence ATCTGAGGCTAGGAGAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951816041_951816046 21 Left 951816041 3:26756069-26756091 CCAAATTTCTCCTAGCCTCAGAT No data
Right 951816046 3:26756113-26756135 ATAAAAATATCTATAAAGCATGG No data
951816041_951816045 -2 Left 951816041 3:26756069-26756091 CCAAATTTCTCCTAGCCTCAGAT No data
Right 951816045 3:26756090-26756112 ATACTTTGTTTTTAAAAACAGGG No data
951816041_951816044 -3 Left 951816041 3:26756069-26756091 CCAAATTTCTCCTAGCCTCAGAT No data
Right 951816044 3:26756089-26756111 GATACTTTGTTTTTAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951816041 Original CRISPR ATCTGAGGCTAGGAGAAATT TGG (reversed) Intergenic
No off target data available for this crispr