ID: 951819954

View in Genome Browser
Species Human (GRCh38)
Location 3:26797180-26797202
Sequence TACTACTGGACTGCAGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951819951_951819954 2 Left 951819951 3:26797155-26797177 CCAGTATTTCCTTTATGACTGTC No data
Right 951819954 3:26797180-26797202 TACTACTGGACTGCAGACTTTGG No data
951819952_951819954 -7 Left 951819952 3:26797164-26797186 CCTTTATGACTGTCATTACTACT No data
Right 951819954 3:26797180-26797202 TACTACTGGACTGCAGACTTTGG No data
951819950_951819954 10 Left 951819950 3:26797147-26797169 CCTCAAGGCCAGTATTTCCTTTA No data
Right 951819954 3:26797180-26797202 TACTACTGGACTGCAGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951819954 Original CRISPR TACTACTGGACTGCAGACTT TGG Intergenic
No off target data available for this crispr