ID: 951821804

View in Genome Browser
Species Human (GRCh38)
Location 3:26822125-26822147
Sequence CCTAATAAGCAGATATAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951821804_951821811 29 Left 951821804 3:26822125-26822147 CCTAGCTATATCTGCTTATTAGG No data
Right 951821811 3:26822177-26822199 GCTCTTGAAGGTCTCCACTCGGG No data
951821804_951821808 17 Left 951821804 3:26822125-26822147 CCTAGCTATATCTGCTTATTAGG No data
Right 951821808 3:26822165-26822187 TTTTCCAGCTCTGCTCTTGAAGG No data
951821804_951821810 28 Left 951821804 3:26822125-26822147 CCTAGCTATATCTGCTTATTAGG No data
Right 951821810 3:26822176-26822198 TGCTCTTGAAGGTCTCCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951821804 Original CRISPR CCTAATAAGCAGATATAGCT AGG (reversed) Intergenic
No off target data available for this crispr