ID: 951823602

View in Genome Browser
Species Human (GRCh38)
Location 3:26842384-26842406
Sequence ACCTGAGTCTGCAGGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951823598_951823602 -6 Left 951823598 3:26842367-26842389 CCAGTTCTTCTCAGACCACCTGA No data
Right 951823602 3:26842384-26842406 ACCTGAGTCTGCAGGGAACCTGG No data
951823597_951823602 -5 Left 951823597 3:26842366-26842388 CCCAGTTCTTCTCAGACCACCTG No data
Right 951823602 3:26842384-26842406 ACCTGAGTCTGCAGGGAACCTGG No data
951823595_951823602 1 Left 951823595 3:26842360-26842382 CCCTCTCCCAGTTCTTCTCAGAC No data
Right 951823602 3:26842384-26842406 ACCTGAGTCTGCAGGGAACCTGG No data
951823596_951823602 0 Left 951823596 3:26842361-26842383 CCTCTCCCAGTTCTTCTCAGACC No data
Right 951823602 3:26842384-26842406 ACCTGAGTCTGCAGGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951823602 Original CRISPR ACCTGAGTCTGCAGGGAACC TGG Intergenic
No off target data available for this crispr