ID: 951839537

View in Genome Browser
Species Human (GRCh38)
Location 3:27019470-27019492
Sequence ATCAATAAGGGACCTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951839537_951839542 8 Left 951839537 3:27019470-27019492 CCCACAAAAGGTCCCTTATTGAT No data
Right 951839542 3:27019501-27019523 AAAACTAATTCAGTATGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951839537 Original CRISPR ATCAATAAGGGACCTTTTGT GGG (reversed) Intergenic
No off target data available for this crispr