ID: 951841562

View in Genome Browser
Species Human (GRCh38)
Location 3:27039438-27039460
Sequence TTTGTTAGGTCCTTTTTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951841562_951841564 2 Left 951841562 3:27039438-27039460 CCACGGAAAAAGGACCTAACAAA No data
Right 951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG No data
951841562_951841567 10 Left 951841562 3:27039438-27039460 CCACGGAAAAAGGACCTAACAAA No data
Right 951841567 3:27039471-27039493 TTAGAAGAATGAAGGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951841562 Original CRISPR TTTGTTAGGTCCTTTTTCCG TGG (reversed) Intergenic
No off target data available for this crispr