ID: 951841564

View in Genome Browser
Species Human (GRCh38)
Location 3:27039463-27039485
Sequence ACGCCCTTTTAGAAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951841562_951841564 2 Left 951841562 3:27039438-27039460 CCACGGAAAAAGGACCTAACAAA No data
Right 951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951841564 Original CRISPR ACGCCCTTTTAGAAGAATGA AGG Intergenic
No off target data available for this crispr