ID: 951841851

View in Genome Browser
Species Human (GRCh38)
Location 3:27043313-27043335
Sequence GACCAAACCATACCAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951841846_951841851 -1 Left 951841846 3:27043291-27043313 CCCAGACTCAAAAGAGCACTGGG No data
Right 951841851 3:27043313-27043335 GACCAAACCATACCAAAGGAGGG No data
951841843_951841851 3 Left 951841843 3:27043287-27043309 CCTCCCCAGACTCAAAAGAGCAC No data
Right 951841851 3:27043313-27043335 GACCAAACCATACCAAAGGAGGG No data
951841842_951841851 8 Left 951841842 3:27043282-27043304 CCAAACCTCCCCAGACTCAAAAG No data
Right 951841851 3:27043313-27043335 GACCAAACCATACCAAAGGAGGG No data
951841844_951841851 0 Left 951841844 3:27043290-27043312 CCCCAGACTCAAAAGAGCACTGG No data
Right 951841851 3:27043313-27043335 GACCAAACCATACCAAAGGAGGG No data
951841848_951841851 -2 Left 951841848 3:27043292-27043314 CCAGACTCAAAAGAGCACTGGGA No data
Right 951841851 3:27043313-27043335 GACCAAACCATACCAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951841851 Original CRISPR GACCAAACCATACCAAAGGA GGG Intergenic
No off target data available for this crispr