ID: 951844618

View in Genome Browser
Species Human (GRCh38)
Location 3:27072270-27072292
Sequence GGTGCTGATGCTGCTTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951844618_951844625 23 Left 951844618 3:27072270-27072292 CCCAGACAAGCAGCATCAGCACC No data
Right 951844625 3:27072316-27072338 AGATTCTTCAACTCCATCTCAGG No data
951844618_951844623 -10 Left 951844618 3:27072270-27072292 CCCAGACAAGCAGCATCAGCACC No data
Right 951844623 3:27072283-27072305 CATCAGCACCACTGGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951844618 Original CRISPR GGTGCTGATGCTGCTTGTCT GGG (reversed) Intergenic
No off target data available for this crispr