ID: 951853344

View in Genome Browser
Species Human (GRCh38)
Location 3:27167895-27167917
Sequence CAACATGAGCAAATGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951853344_951853351 28 Left 951853344 3:27167895-27167917 CCTAGTTCCATTTGCTCATGTTG 0: 1
1: 0
2: 0
3: 32
4: 176
Right 951853351 3:27167946-27167968 AAGCATATCCTAAGTTATTAGGG 0: 1
1: 0
2: 1
3: 13
4: 161
951853344_951853346 -8 Left 951853344 3:27167895-27167917 CCTAGTTCCATTTGCTCATGTTG 0: 1
1: 0
2: 0
3: 32
4: 176
Right 951853346 3:27167910-27167932 TCATGTTGTATCCATTTGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 170
951853344_951853350 27 Left 951853344 3:27167895-27167917 CCTAGTTCCATTTGCTCATGTTG 0: 1
1: 0
2: 0
3: 32
4: 176
Right 951853350 3:27167945-27167967 AAAGCATATCCTAAGTTATTAGG 0: 1
1: 0
2: 4
3: 13
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951853344 Original CRISPR CAACATGAGCAAATGGAACT AGG (reversed) Intronic
900037084 1:423261-423283 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900058714 1:659002-659024 CAGCATGAGCAAATGCAAGGAGG + Intergenic
901217037 1:7560779-7560801 CATCATGAGAACATGGGACTCGG + Intronic
902966745 1:20010510-20010532 CAGCATGAACCCATGGAACTTGG - Intergenic
903522703 1:23964293-23964315 CAAAATGAGTAAATGGAAGTGGG + Intergenic
904033272 1:27546291-27546313 CAAAATGATCAAAGGGAACAAGG - Intronic
906718192 1:47985937-47985959 CAACATGAGCAAATGCATGGAGG + Intronic
906814241 1:48861831-48861853 CAACAAAATGAAATGGAACTTGG + Intronic
907705346 1:56827771-56827793 CATCATGTGCAAATTGCACTGGG + Intergenic
909291194 1:73885761-73885783 CAACTTGAACAAAGGCAACTGGG + Intergenic
909346427 1:74593043-74593065 ATACATGAACAAATGGAATTGGG - Intronic
914934140 1:151963158-151963180 CAACATAAGGGAATGGAATTTGG + Intergenic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
916678115 1:167081349-167081371 CAACACCAGCACATGGTACTTGG - Intronic
918837981 1:189493873-189493895 CAAAATGACGAAATGTAACTTGG + Intergenic
920516759 1:206590567-206590589 CGGCATGAGCATATGAAACTAGG - Intronic
920637476 1:207718214-207718236 CACCATTAACAAAGGGAACTCGG + Intronic
923679512 1:236108207-236108229 GCACATGAGCAAATGGATTTGGG + Intergenic
923843592 1:237702401-237702423 GAACATGAGAAAATAAAACTAGG - Intronic
1063310538 10:4948051-4948073 AAACAAGAGCTAATGGAAGTTGG + Intronic
1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG + Intergenic
1067252896 10:44603005-44603027 CATATTGAGAAAATGGAACTAGG - Intergenic
1068320725 10:55410816-55410838 GAACATGGGGAAATGGGACTGGG - Intronic
1068756421 10:60659350-60659372 GGAAAAGAGCAAATGGAACTGGG - Intronic
1070940503 10:80341607-80341629 CAACATCAGCTACTGTAACTAGG + Intronic
1073079248 10:100847528-100847550 CAACATGAGCAAATGACATTTGG - Intergenic
1075036512 10:119073730-119073752 CAACAGGTACAAACGGAACTGGG - Exonic
1076963810 11:61183-61205 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1077936441 11:6792638-6792660 AAACAGGATCAAATGGAACAAGG + Intergenic
1078974559 11:16457627-16457649 CAGCAAGAACAAATGGACCTTGG - Intronic
1084669836 11:70598671-70598693 CAATATTAGCAAATGGAATTTGG + Intronic
1087152618 11:94872355-94872377 AAGCATGAGCAAAGGGAACTGGG - Exonic
1088594425 11:111429367-111429389 ACACATGAGGAAATGGAACAAGG + Intronic
1089116754 11:116101437-116101459 CAACATAAGCAAAGGGACATTGG + Intergenic
1089885447 11:121817348-121817370 CAACATGAGCAAGGGGAAATAGG - Intergenic
1090320894 11:125842723-125842745 CTGCAGGAGCAAAGGGAACTTGG - Intergenic
1093312442 12:17606979-17607001 CAAAATTAGCAATTAGAACTAGG + Intergenic
1094292949 12:28872667-28872689 CAATGTGAGCAAAAGCAACTTGG + Intergenic
1095597063 12:43971249-43971271 CCACATGAACATATTGAACTAGG - Intronic
1096668327 12:53181472-53181494 CAACAGGAGCAAAAGTAATTGGG - Intronic
1103524828 12:121560737-121560759 CCACAGGAGCAAAGGGAACCAGG + Intronic
1106294262 13:28396007-28396029 CCAGATGAGCAAATGGGATTTGG - Intronic
1106650864 13:31688532-31688554 CAACCTGGGAAAATGGAGCTTGG + Intergenic
1106695238 13:32165864-32165886 TAAAATGAGGAAATAGAACTTGG - Intronic
1107224922 13:38037423-38037445 CAATATGTGCCAAAGGAACTAGG - Intergenic
1107691064 13:42953665-42953687 CAACATGAGCAGAAGTACCTTGG + Intronic
1109194890 13:59367732-59367754 CAACATGTTACAATGGAACTAGG + Intergenic
1109912436 13:68932562-68932584 TAAAATGAGCAAAAGGGACTAGG - Intergenic
1110715626 13:78700699-78700721 CAACAAGTACTAATGGAACTTGG + Intergenic
1111154634 13:84306761-84306783 CAAGCTGAGAAATTGGAACTTGG - Intergenic
1115239633 14:31241827-31241849 AAACATGTGCATATGCAACTGGG + Intergenic
1116390975 14:44388834-44388856 CAACATGAGTTGATAGAACTGGG - Intergenic
1118093337 14:62507792-62507814 TGACATAACCAAATGGAACTAGG - Intergenic
1118485128 14:66207351-66207373 AAACATGAGGAAATGGGATTTGG + Intergenic
1119193346 14:72699577-72699599 CAACATAAGCCAAAGGAACAGGG + Intronic
1125865602 15:43045106-43045128 CAAAATGAGAAAATGCAAGTTGG + Intronic
1127170687 15:56298070-56298092 CAACATGGGCAGAAGCAACTTGG - Intronic
1128822458 15:70671825-70671847 CTTCATCAGCACATGGAACTAGG - Intronic
1132061084 15:98693005-98693027 CACCACGGGCAAATGGAACACGG - Intronic
1132444743 15:101903990-101904012 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1133713324 16:8422870-8422892 CACCATGGGCCAATGGAAATGGG - Intergenic
1136720316 16:32314753-32314775 AAACATGAACAAATGGAGCTGGG - Intergenic
1136725369 16:32353145-32353167 AAACATGAACAAATGGAGCTGGG - Intergenic
1136838693 16:33521029-33521051 AAACATGAACAAATGGAGCTGGG - Intergenic
1136843702 16:33559203-33559225 AAACATGAACAAATGGAGCTGGG - Intergenic
1139515399 16:67449704-67449726 CAGCTTTAGCAAATGGAACTGGG - Intronic
1139701818 16:68712347-68712369 CAACAAGAGCAGCTGGAGCTGGG + Intronic
1140041046 16:71408377-71408399 CAGCCTGATCAACTGGAACTTGG - Intergenic
1140308957 16:73830674-73830696 CAACATCAACAAATTGCACTTGG + Intergenic
1142299125 16:89246630-89246652 CAACATGAGCACATGGACACAGG + Intergenic
1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG + Intergenic
1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG + Intergenic
1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG + Intergenic
1203148858 16_KI270728v1_random:1821315-1821337 AAACATGAACAAATGGAGCTGGG - Intergenic
1203153867 16_KI270728v1_random:1859501-1859523 AAACATGAACAAATGGAGCTGGG - Intergenic
1142942247 17:3390293-3390315 AAAAATGAGCAAATGGAATGTGG + Intergenic
1143265499 17:5634088-5634110 CAGCATGAGCATATGGAAACCGG - Intergenic
1147991168 17:44334422-44334444 CAACCTTAGCAAAAGGAACAGGG + Intergenic
1150106787 17:62468036-62468058 TAACATGAGGAGATTGAACTAGG + Intronic
1155564993 18:27124237-27124259 CAACATGAGCCAAGTTAACTTGG + Intronic
1156699301 18:39806181-39806203 CAACATGAGCAACTGGAGGGAGG - Intergenic
1156745065 18:40380521-40380543 AAACATGTGCAAATGTATCTTGG - Intergenic
1160640613 19:130814-130836 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1167338767 19:48902781-48902803 CAGCATGAGCAAAGGCCACTTGG + Intronic
1167782751 19:51610813-51610835 CAATATGAGCAAATGCCCCTGGG + Intergenic
1168498611 19:56874929-56874951 GAACAAGTGCAAATGGATCTGGG - Intergenic
925807313 2:7663535-7663557 AAACATGAGGAAATGGAACACGG - Intergenic
927304037 2:21549712-21549734 CATCATGAGAAAAGGGAATTAGG + Intergenic
928642258 2:33312638-33312660 CAACATGAATATTTGGAACTAGG - Intronic
929753579 2:44742777-44742799 CAAAATAAGCAAATATAACTGGG + Intronic
929912289 2:46100403-46100425 CCACAGGAGCAAATACAACTTGG - Intronic
931087097 2:58844642-58844664 CAGCAAGAGTAAATGGCACTGGG + Intergenic
932335880 2:70931155-70931177 CTACATGAGGAAAGGGAACTGGG - Intronic
932550825 2:72767507-72767529 CCACATTAACAATTGGAACTGGG + Intronic
934320513 2:91967413-91967435 AAACATGAACAAATGGAGCTGGG + Intergenic
934779690 2:96961699-96961721 GGACATGAGCAACTGGCACTGGG + Intronic
936587120 2:113767872-113767894 CAGGATAAGGAAATGGAACTTGG + Intergenic
936732218 2:115396552-115396574 CAAAATGAGAAAAGGGACCTTGG + Intronic
937991729 2:127666143-127666165 CACCATGACCAAATGGGATTTGG + Intronic
938697706 2:133849467-133849489 CAACATGTTCACCTGGAACTCGG + Intergenic
941173842 2:162172661-162172683 GAACATTAGCAAATGAATCTTGG - Intronic
945473148 2:210250385-210250407 CATCATCAATAAATGGAACTGGG - Intergenic
945770078 2:214032023-214032045 CACTATGAGCAACTGGAACTTGG - Intronic
1169286825 20:4315350-4315372 AAAAAAGAGCAAATGCAACTGGG + Intergenic
1169787486 20:9375718-9375740 CAACATCTGCAAATGAGACTAGG - Intronic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1175612225 20:60361307-60361329 CAAAATGAGCAAATGCAAGATGG + Intergenic
1179345605 21:40553857-40553879 ATAAATGAGAAAATGGAACTAGG - Intronic
1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG + Intergenic
1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG + Intergenic
1181097870 22:20518364-20518386 CAACATGAAGAAAGGTAACTTGG - Intronic
1181858109 22:25797279-25797301 CCACATGAGCAAAGGGGATTTGG - Intronic
1182061583 22:27402294-27402316 CATCCTGAGCAAATGGACCCAGG + Intergenic
1182211925 22:28684051-28684073 AAACATGAACAAATGGAGCTGGG - Intergenic
1183172978 22:36201621-36201643 CACCATGAGCCAGTAGAACTGGG + Intronic
951853344 3:27167895-27167917 CAACATGAGCAAATGGAACTAGG - Intronic
953205269 3:40822269-40822291 TACCATGAGCATTTGGAACTTGG + Intergenic
954371103 3:50169971-50169993 CACCATGAGGCAAAGGAACTGGG - Intronic
955862760 3:63349735-63349757 CAAAATGAGTAGAAGGAACTTGG - Intronic
956004713 3:64766153-64766175 CAACATTAGCACATGGCATTAGG - Intergenic
956861341 3:73327005-73327027 CAACAGGAGCAAGCGGGACTCGG - Intergenic
957283447 3:78184190-78184212 CAAAATGGGCAAAGGGAATTTGG + Intergenic
957529575 3:81424078-81424100 CAACAGGAGAAAATGAATCTTGG - Intergenic
957840525 3:85662931-85662953 AAGCATGAGAAAAAGGAACTAGG - Intronic
958889844 3:99771128-99771150 CAACAGGTGGAAATGGAATTAGG + Intronic
960288133 3:115852829-115852851 GAAAATGGGAAAATGGAACTTGG + Intronic
961123457 3:124394515-124394537 CAAGATGATAAAATGCAACTAGG - Intronic
961125867 3:124416922-124416944 TTACAGTAGCAAATGGAACTAGG + Intronic
962485939 3:135842356-135842378 CCTCATGAGCAATTGGAAGTGGG - Intergenic
963928401 3:150976361-150976383 TGACATAAGAAAATGGAACTAGG + Intergenic
966318695 3:178677103-178677125 CACCATGAGGAAATGAAAGTTGG - Intronic
967620038 3:191621877-191621899 AAAGATGAGCAAATGAAAATAGG - Intergenic
970775332 4:19668100-19668122 AAACAAGAGCATATGGAACCGGG + Intergenic
970997781 4:22287616-22287638 AAAGATGAGGAAATGGAACCTGG - Intergenic
974138905 4:57857777-57857799 CAAAATGAGCTAATGGAAATAGG - Intergenic
974319632 4:60330081-60330103 AAACATAAGCAAAAGTAACTTGG + Intergenic
974718450 4:65702865-65702887 GAGCATGAGCAAAGGAAACTGGG - Intergenic
978346836 4:107779460-107779482 CAACATGAGAAAAATGGACTAGG - Intergenic
979040622 4:115788374-115788396 ACACATGAGCAAAAAGAACTAGG - Intergenic
981114050 4:140969109-140969131 CAGCCTGAGCAAATGTAACCTGG - Intronic
983146702 4:164225360-164225382 CATCATGGGCAAATAGAAATAGG - Intronic
984458540 4:180002595-180002617 CAACAAAAGAAAATGGAACATGG - Intergenic
985972698 5:3390960-3390982 CCACATGAGAAAAGGGGACTTGG - Intergenic
986465340 5:8015417-8015439 CCAACTGAGCAAATGGAACTAGG + Intergenic
988102948 5:26705979-26706001 CAACATTGCCAAATGGAATTTGG - Intergenic
989115543 5:37948992-37949014 CACCATGGGCAACTGGACCTTGG + Intergenic
991138153 5:63207524-63207546 CAAAATGAACAAAGGGAACCTGG - Intergenic
999798637 5:155011591-155011613 AAATATGAGTAAATGGAATTTGG + Intergenic
1002736737 5:181395605-181395627 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1002747962 6:79217-79239 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1006606673 6:35262365-35262387 CAACTTGAGAAAATGGCAGTAGG - Intronic
1007929749 6:45679431-45679453 CCAAATGAGCAGGTGGAACTGGG - Intergenic
1009010756 6:57839457-57839479 GAACATGAGTAACAGGAACTGGG + Intergenic
1009433341 6:63590607-63590629 CAACTAGATCAAATGGGACTTGG + Intergenic
1009755855 6:67939340-67939362 TAACATGAGCAAATTGGAGTTGG - Intergenic
1010089146 6:71959298-71959320 TAAAATGGGAAAATGGAACTTGG - Intronic
1010566814 6:77425817-77425839 CACAATGAACTAATGGAACTGGG + Intergenic
1011773916 6:90707096-90707118 CACCCTGGGAAAATGGAACTTGG - Intergenic
1012337085 6:98073571-98073593 CAAAATGAGGAAATGGAGTTGGG + Intergenic
1012972000 6:105741261-105741283 CAACAAGAGCAAACCAAACTGGG + Intergenic
1015654578 6:135502842-135502864 CAACATATGCATTTGGAACTGGG + Intergenic
1016357570 6:143234869-143234891 TAACATGAGCAAACGCTACTTGG + Intronic
1017150180 6:151272389-151272411 AAACATGACCAAATGCAATTTGG - Intronic
1017938327 6:159027048-159027070 AAAGAAAAGCAAATGGAACTGGG - Intergenic
1019091058 6:169534058-169534080 CAACAGCAGCAAATGGAAGGGGG - Intronic
1019241836 6:170671134-170671156 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1023313514 7:38911469-38911491 TCACATGAGCAAATGGGATTTGG - Intronic
1023484537 7:40670997-40671019 AAATATTAGCAAATGGAATTTGG + Intronic
1027766831 7:82354383-82354405 CAACATGAGAATGTGGAAGTGGG + Intronic
1029989912 7:104953540-104953562 CAAAATTAGCAAGTGGAAATTGG - Intergenic
1031270932 7:119648098-119648120 TAACATGAGTAAATAGAATTAGG - Intergenic
1032035832 7:128520578-128520600 TAACATGAGGAGATTGAACTAGG + Intergenic
1033895706 7:146066752-146066774 CACCATGAGAAAATGGAACCAGG + Intergenic
1034720588 7:153289198-153289220 CAAGATGAGCAAATAGAAGTTGG + Intergenic
1035158264 7:156931976-156931998 CAAAATAAGCAAATGTATCTTGG + Intergenic
1035506281 8:136962-136984 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1035843896 8:2842462-2842484 CAACAGGTGCATATGCAACTAGG + Intergenic
1036060368 8:5311343-5311365 CAACATGTGCAAATCGTCCTTGG + Intergenic
1036574652 8:10015311-10015333 AAACTTTGGCAAATGGAACTAGG + Intergenic
1038875207 8:31540957-31540979 CAACAGGAGCAATTAGAAATGGG - Intergenic
1039836304 8:41258925-41258947 AGACATGAGCAAATGGAACAGGG + Intergenic
1039869126 8:41530373-41530395 CAAGATGAGGAAACGGAATTTGG + Intronic
1042767862 8:72346101-72346123 CAAGATGAGAAAATGCAAGTTGG - Intergenic
1043816101 8:84803423-84803445 CTACATAAGCAAACAGAACTAGG - Intronic
1044517871 8:93160457-93160479 CAACAAGAGCAAATGAAAAGAGG - Intronic
1046196531 8:110871249-110871271 CAAGATGGGGAAATGGAAGTCGG - Intergenic
1047103002 8:121700964-121700986 TAACATGGGGAAATGGAAGTAGG - Intergenic
1048010407 8:130450825-130450847 CAAAAAGAGAAAATGGATCTGGG + Intergenic
1048540125 8:135334748-135334770 CAATATGAGCAATTGGTACTGGG - Intergenic
1048904834 8:139077547-139077569 CAAGATGAGCATATGGATTTCGG - Intergenic
1049399450 8:142418408-142418430 CCACAGGAGCAAATGGGACAGGG - Intergenic
1052886781 9:33656950-33656972 TAACCTGAGCTAATAGAACTCGG + Intergenic
1053104554 9:35398784-35398806 CACCATGAGCATATGGGAATGGG + Intronic
1055473311 9:76635543-76635565 CAGCATTAGCAATTGGAAGTGGG + Intronic
1055683466 9:78743155-78743177 GAACCTGAGCTAATAGAACTCGG - Intergenic
1057346628 9:94257332-94257354 CAACTTGAGGAGATGGAACTGGG - Intergenic
1203602027 Un_KI270748v1:20368-20390 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1186103112 X:6177692-6177714 CAACATTAAAAAATGGAAATAGG + Intronic
1189130139 X:38490035-38490057 CAACATGAGACAAGGGAACTGGG + Intronic
1189716774 X:43875168-43875190 CAACCTGATCAAATGGTGCTGGG - Intronic
1190794759 X:53730689-53730711 CAACATAAGCAAAAGGAAGGTGG + Intergenic
1195572886 X:106416003-106416025 TAACATGAGCAGAGAGAACTTGG - Intergenic
1196432513 X:115641960-115641982 CAGCATGAGCAAAGGCACCTGGG - Intronic
1196810097 X:119621933-119621955 CAAGATGAGTAAATGGAAGCTGG - Intronic
1199443434 X:147895150-147895172 CAACATTAGCATTTGGAGCTGGG - Intergenic
1199659718 X:150036827-150036849 CAACTTGAGCAAAAGTAACAAGG + Intergenic
1199790553 X:151151398-151151420 CACCATAAGCAACTGGAAGTTGG - Intergenic
1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG + Intergenic
1201492305 Y:14555622-14555644 CAACATTTGAAAATGGAAATAGG - Intronic