ID: 951855902

View in Genome Browser
Species Human (GRCh38)
Location 3:27196618-27196640
Sequence GTCCTGGGTAGCCATAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951855894_951855902 2 Left 951855894 3:27196593-27196615 CCCTACTAGTATGTTAACCCCAA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 951855902 3:27196618-27196640 GTCCTGGGTAGCCATAGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 142
951855893_951855902 3 Left 951855893 3:27196592-27196614 CCCCTACTAGTATGTTAACCCCA 0: 1
1: 0
2: 1
3: 25
4: 157
Right 951855902 3:27196618-27196640 GTCCTGGGTAGCCATAGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 142
951855892_951855902 22 Left 951855892 3:27196573-27196595 CCAATGTTGCTATCTGACTCCCC 0: 1
1: 0
2: 0
3: 9
4: 148
Right 951855902 3:27196618-27196640 GTCCTGGGTAGCCATAGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 142
951855895_951855902 1 Left 951855895 3:27196594-27196616 CCTACTAGTATGTTAACCCCAAG 0: 1
1: 0
2: 0
3: 13
4: 128
Right 951855902 3:27196618-27196640 GTCCTGGGTAGCCATAGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951855902 Original CRISPR GTCCTGGGTAGCCATAGCCA GGG Intronic
900312861 1:2042881-2042903 GCCCTGGGAAGACACAGCCAAGG - Intergenic
902240995 1:15089254-15089276 TTCTTGGGGAGACATAGCCAAGG + Intronic
902919212 1:19656539-19656561 GTCCTGGGTGGCCTTAGTGAGGG + Intronic
903278545 1:22236905-22236927 GTCCTGTGGCCCCATAGCCAGGG + Intergenic
905325545 1:37149272-37149294 TCCCTGGGTAGCCAAAGCCCAGG + Intergenic
905624787 1:39481813-39481835 GTCTTGGAAAGCCTTAGCCAGGG + Intronic
911150095 1:94590233-94590255 GTCTTGGTCAGCCAGAGCCAAGG + Intergenic
913435912 1:118847574-118847596 GTCCTGAGTACCCAGAGTCAAGG + Intergenic
913544297 1:119852033-119852055 TTCCTGGGTATCTATAGCTAGGG + Intergenic
913602488 1:120435316-120435338 TTCCTGGGTATCTATAGCTAGGG - Intergenic
914084560 1:144441191-144441213 TTCCTGGGTATCTATAGCTAGGG + Intronic
914171948 1:145233398-145233420 GACCTGGAAAGCCATTGCCATGG - Intergenic
914190572 1:145406457-145406479 TTCCTGGGTATCTATAGCTAGGG + Intergenic
914363660 1:146958948-146958970 TTCCTGGGTATCTATAGCTAGGG - Intronic
914488015 1:148128178-148128200 TTCCTGGGTATCTATAGCTAGGG + Intronic
914588378 1:149083331-149083353 TTCCTGGGTATCTATAGCTAGGG + Intronic
915346777 1:155201514-155201536 TTCCTGGGCAACCAGAGCCAGGG - Exonic
918947666 1:191090483-191090505 GTCATGAGGAGCCATAACCAAGG - Intergenic
921914644 1:220593818-220593840 GTCCTGGGTAGGCCCAGGCAGGG + Intronic
923623789 1:235598007-235598029 GTCTTGGGTAGCCAGAGTCAGGG - Intronic
1062951486 10:1507068-1507090 GTCTTGGGCAGCCATAGCAGCGG - Intronic
1063366367 10:5493320-5493342 GTTCTGGGCAGCCAGAGCCCAGG + Intergenic
1072445144 10:95492924-95492946 GTCGTAGGTAGGCATTGCCAGGG - Intronic
1077052020 11:571213-571235 GCCATAGGAAGCCATAGCCAAGG + Intergenic
1077999651 11:7483466-7483488 GTCCTGGCTAGTAATAGCAACGG + Intergenic
1079120868 11:17684021-17684043 GTCCAGGGAAGCCATCACCAAGG + Intergenic
1079446233 11:20558618-20558640 GTCCTGGGTAGCCAGCACCTTGG + Intergenic
1080010287 11:27452200-27452222 GTCCTGAGAAGTCTTAGCCATGG - Intronic
1080639562 11:34150827-34150849 GTGCTGGGTGGCCACAGCAATGG + Intergenic
1083758867 11:64805182-64805204 GTCCAGGGCACCCAGAGCCAAGG - Exonic
1084471069 11:69359175-69359197 GTTCTGGGCTGCCTTAGCCAGGG - Intronic
1095559210 12:43545590-43545612 GTCCTTGGGAGCTATGGCCAGGG - Intronic
1100396030 12:94187093-94187115 GTACTGGGTTGCCATGGCGACGG - Intronic
1101877189 12:108603597-108603619 CTTCTGGGCAGCCATGGCCAGGG - Intergenic
1102988860 12:117300451-117300473 GTCCTGGGTGGTCAGAGCCAGGG - Intronic
1103779189 12:123388422-123388444 GCCCTGGGGAGACAGAGCCAGGG - Intronic
1109981024 13:69907553-69907575 GTCATGGGTAGAGATAGACAAGG + Intronic
1114708592 14:24753595-24753617 TTGCTGGGAAGCCATAGCCGTGG + Intergenic
1116044966 14:39733016-39733038 ATCCTTGGTAGATATAGCCAAGG - Intergenic
1118817260 14:69322337-69322359 TTCATGGGCAGCCCTAGCCATGG + Intronic
1119468148 14:74875987-74876009 GCCCTGGGCAGACAGAGCCATGG + Intergenic
1121403468 14:93703217-93703239 GTCCTGGGAAGCCAGAACAAGGG - Intronic
1127472192 15:59300271-59300293 GTGCTGGGCAGGCAGAGCCATGG - Intronic
1128187556 15:65655998-65656020 TTGCTGGGTTTCCATAGCCAAGG + Exonic
1128411794 15:67406689-67406711 TTCCTGGGGTTCCATAGCCAGGG + Intronic
1128457693 15:67841501-67841523 GACCTGGGGAGCCACTGCCAGGG + Intergenic
1128925750 15:71653911-71653933 GTCCTGTGCAGCCAAAACCAAGG - Intronic
1130015301 15:80181312-80181334 GTCCCGGGTAGCCATAGCTGTGG - Intronic
1130545678 15:84856498-84856520 CTCCTGGGTTTCCATATCCATGG - Exonic
1130966323 15:88700323-88700345 GTCCCTGGTAGCCATGGGCAGGG - Intergenic
1130979917 15:88805156-88805178 GTCCTGGGTTGCCATGGACAAGG + Intronic
1132639969 16:973481-973503 GTCCGGGGTGGGCAAAGCCACGG + Intronic
1134147017 16:11773369-11773391 AGCCTGGGTAACCATAGCAAGGG - Intronic
1135577396 16:23596287-23596309 ATCCTGGGTTGGCGTAGCCATGG - Exonic
1136072103 16:27793752-27793774 CTCCTGGGTAGCCAGAGAAAGGG - Intronic
1137973746 16:53012430-53012452 CTCCTCGGCAGCCAGAGCCATGG + Intergenic
1138113034 16:54339748-54339770 TTGCTGGTTAGCCATAGGCAGGG + Intergenic
1143649629 17:8255533-8255555 GTGCAGGGTAGCCAGAGCAATGG - Exonic
1144706688 17:17373187-17373209 GTGCTGGGAAGCCAGAGACAGGG - Intergenic
1146833832 17:36093891-36093913 GTGATGGGTCTCCATAGCCAAGG + Intergenic
1146943094 17:36857355-36857377 ATTCTCGGTAGCCACAGCCAGGG - Intergenic
1148738806 17:49880461-49880483 GGCCTGGGCTGCCATAGCCGGGG - Intergenic
1148958066 17:51370242-51370264 GTTCTGGGGAGTCAGAGCCAGGG + Intergenic
1151362547 17:73597219-73597241 GTGCTGGGTAGCCAGCACCAGGG - Intronic
1151474876 17:74339707-74339729 GTCCTGGCTTGTGATAGCCAGGG - Intronic
1157479229 18:48042524-48042546 GTCCTGGGAAGGCAGAGGCAGGG + Intronic
1158614375 18:58972622-58972644 TTCCTGTGTGGCCAGAGCCAAGG - Intronic
1158955698 18:62535671-62535693 GTCCTGGGAAGCCTCAGCCCTGG - Intronic
1160431239 18:78814202-78814224 GTCCTGGGCAGTGATGGCCATGG - Intergenic
1162437097 19:10667762-10667784 ATCCAGGGAAACCATAGCCAAGG + Intronic
1162440667 19:10690240-10690262 GGCCTGGGTAACCCCAGCCATGG + Exonic
1163775071 19:19212801-19212823 GTCCTGGGGATCCATAGCTGGGG - Intronic
1164916688 19:32057872-32057894 GTCCCTGGTATCCATTGCCAAGG + Intergenic
1166390989 19:42408860-42408882 GACCTGGGTAGCGACAGTCAGGG + Intronic
928331563 2:30361549-30361571 GTCCTGGGTTGAGAGAGCCATGG - Intergenic
929828032 2:45325238-45325260 CTCCAGGGTGGCCAGAGCCAAGG + Intergenic
929876882 2:45804197-45804219 ATGCTGCGTAGCCAAAGCCAAGG + Intronic
929876890 2:45804241-45804263 ATGCTGTGTAGCCAAAGCCAAGG + Intronic
930097053 2:47572780-47572802 GTCCAGGGGAGCCAAAGCCTTGG - Intergenic
935330667 2:101975105-101975127 GTCCTGAGTGGCCACAGACATGG + Intergenic
939585369 2:143997905-143997927 GTCCTGGACAGCTACAGCCAGGG - Intronic
1169197724 20:3692485-3692507 CTCCTGGGCAGCCCTGGCCAAGG + Intronic
1169353465 20:4888893-4888915 GTCCTGGTTAGCCAGATTCAGGG + Intronic
1170440435 20:16374032-16374054 GACCTGGCTAGCCAGATCCAAGG - Intronic
1170839405 20:19911937-19911959 GTCTTGTGGACCCATAGCCATGG - Intronic
1170852394 20:20017175-20017197 GTTCTGGGCAGCCACAGCCCCGG + Exonic
1171126417 20:22605787-22605809 GTCCTGGGCAGCCACAGAAAAGG - Intergenic
1173925688 20:46779590-46779612 ATCCTGGGTAGCCCAAGCCATGG - Intergenic
1176184661 20:63771649-63771671 GTCCAGGGAAGCCTTAGCCGAGG - Intronic
1178494794 21:33077614-33077636 GTCCTGGTTCCCCACAGCCATGG + Intergenic
1179972357 21:44843199-44843221 GCCCTGGGTAGCCACCTCCACGG + Intergenic
1181737344 22:24892267-24892289 GTCCTGAGTAGCCATAGGAGAGG + Intronic
1183507364 22:38216712-38216734 CTCCTGGGAAGACAAAGCCATGG + Intergenic
1184371822 22:44087359-44087381 GTCCTGGGGGGCCAGAGCAATGG - Intronic
1184820363 22:46905484-46905506 GTCCTGAGTAGCCATCCCCTGGG + Intronic
951855902 3:27196618-27196640 GTCCTGGGTAGCCATAGCCAGGG + Intronic
952643604 3:35628135-35628157 GTCCAGGGTATGCATTGCCAGGG - Intergenic
954082961 3:48223347-48223369 GTCCTGTGAAGCAATAGCCAGGG + Exonic
954364204 3:50137712-50137734 GTCCTGGAGAGTCATGGCCAGGG - Intergenic
954644233 3:52121173-52121195 CTTCTGGTGAGCCATAGCCAAGG - Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
967004685 3:185373135-185373157 TTCTTGGGTAGTGATAGCCAAGG + Intronic
967956525 3:194881517-194881539 GTCTTGGGTAGCCAGAGGCAGGG - Intergenic
968486516 4:865652-865674 GTGCTGCGTGGCCAGAGCCAGGG - Intronic
968664727 4:1814859-1814881 GCCCTGGGAAGCCATGGCCCAGG - Intronic
969542984 4:7805329-7805351 AGCCTGGGTAGCCATTCCCAGGG - Intronic
969641070 4:8399121-8399143 GTCCTGGGGAGCGATGGCCCAGG - Intronic
977621447 4:99142251-99142273 GTCCTGGGTATCCAGAGGAAGGG - Intronic
978311844 4:107393077-107393099 TTCCTGGGTAGCCATTGCTTGGG - Intergenic
979648453 4:123100936-123100958 AGCCTTTGTAGCCATAGCCATGG - Intronic
995850151 5:116536410-116536432 GTCCTGGGGAGCCCGAGTCATGG + Intronic
997378251 5:133414451-133414473 GTCCTTGGTATCCTGAGCCACGG + Intronic
998062236 5:139127829-139127851 GCTCTGGGGAGCCATAGTCAGGG + Exonic
1000373141 5:160556221-160556243 GTCCTAGTTAGCCATAGGGAAGG + Intergenic
1002135021 5:177102126-177102148 GACTTGGGAAGCCCTAGCCAAGG + Intergenic
1003325883 6:5090499-5090521 GTCCAGGGCAGCAAGAGCCACGG + Intergenic
1004125027 6:12864999-12865021 GTGCTGGTTAGCACTAGCCAAGG + Intronic
1005169061 6:22960515-22960537 GTGATGGGTATCCATATCCATGG + Intergenic
1005583130 6:27251684-27251706 GTCCTGGGTAGGGAAAGCCGAGG + Intronic
1018801402 6:167225362-167225384 GACCTGGGAAGACATACCCACGG + Intergenic
1019615163 7:1956154-1956176 GCCCTGGGCATCCAGAGCCAGGG + Intronic
1024628897 7:51231434-51231456 TTCCTGGGGAGCCATATGCAGGG + Intronic
1025019940 7:55472954-55472976 GACCTGGAAAGCCATTGCCATGG + Exonic
1025992031 7:66503923-66503945 GGCCTGGCTGGCCATGGCCATGG - Intergenic
1026890079 7:73976805-73976827 GGGCTGGGTAGTCCTAGCCAGGG + Intergenic
1029118045 7:98248045-98248067 GTGCTTTGTAGGCATAGCCAAGG + Intronic
1030686539 7:112492786-112492808 GTTCTGGGTAACAATAGCCTGGG + Intergenic
1037835753 8:22213902-22213924 GTCCAGGGTAGGCCCAGCCAGGG + Intergenic
1038014060 8:23498294-23498316 GTCCTGGAGAGCTTTAGCCAGGG - Intergenic
1043575739 8:81653976-81653998 GTCCTTGGTAGGCAAAGACAGGG - Intergenic
1045686776 8:104720775-104720797 GTCCTCGATGGCCATAGCAAGGG + Intronic
1049502920 8:142977341-142977363 GTCCTAGGAAGCCAGAGCCCTGG - Intergenic
1049610685 8:143553450-143553472 GTCCTGGGGGGCCAGAGCCTGGG - Exonic
1051727268 9:20101230-20101252 GCCCTGGGCAGGCAGAGCCAAGG + Intergenic
1053371802 9:37567828-37567850 GTGCTGGGCAGACATAGCTAAGG - Intronic
1055497143 9:76867075-76867097 TTCCTGGGCAGCTATAGCCTAGG + Intronic
1057038084 9:91826119-91826141 ATCCTGGGTAGCCCTGGCCAAGG - Intronic
1057497132 9:95570234-95570256 GCCCTGGGTGGCCACTGCCACGG - Intergenic
1057527432 9:95815424-95815446 GTCATGGGTAGCCTTAGCGCAGG - Intergenic
1060280094 9:122209832-122209854 CTCCTGGGTAGCCCTGGGCAAGG + Intronic
1061206477 9:129166867-129166889 GTCCTGGGTAGAGATGGCCCTGG + Intergenic
1186235780 X:7507913-7507935 TTCCTGGGAAGCCATTTCCATGG + Intergenic
1188107690 X:26163759-26163781 GCCTTGGGTGGCCATAGGCAGGG + Intergenic
1188111079 X:26196988-26197010 GCCTTGGGTGGCCATAGGCAGGG + Intergenic
1188187577 X:27133523-27133545 GTCCTGGGTAACCAGACACATGG - Intergenic
1193278935 X:79625260-79625282 GACCTGGGGAAACATAGCCATGG - Intergenic
1195275194 X:103274863-103274885 GGTATGGGTAGGCATAGCCAAGG - Intronic
1195639092 X:107154569-107154591 TTTCTGGGTAGGCATAGCTAAGG + Intronic
1198886484 X:141343965-141343987 ATGCTCAGTAGCCATAGCCAGGG - Intergenic
1199642977 X:149881576-149881598 GCCCTGGGAAGCCCTAGGCATGG + Intronic
1200865671 Y:8040712-8040734 GCCCTGGGTTACCATAGCCCTGG - Intergenic